Busch Lab

ZMP

si:ch211-236h17.3

Ensembl ID:
ENSDARG00000004018
ZFIN IDs:
ZDB-GENE-030131-738, ZDB-GENE-090312-162
Human Orthologue:
CHST13
Human Description:
carbohydrate (chondroitin 4) sulfotransferase 13 [Source:HGNC Symbol;Acc:21755]
Mouse Orthologue:
Chst13
Mouse Description:
carbohydrate (chondroitin 4) sulfotransferase 13 Gene [Source:MGI Symbol;Acc:MGI:1919047]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa17439 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29981
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013449 Nonsense 155 340 3 3
Genomic Location (Zv9):
Chromosome 23 (position 35026784)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 34925645
GRCz11 23 35024559
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCGCCAATGAGGCCCACATAGCAGGCAATCTGCGCTCGCTTTCGGAGTA[C/G]TCAACAGCCGAGATCAACAAGCGTCTACGCACATATCTGAAGTTTGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17439
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013449 Nonsense 169 340 3 3
Genomic Location (Zv9):
Chromosome 23 (position 35026824)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 34925685
GRCz11 23 35024599
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TYTCGGAGTACTCAACAGCCGAGATCAACAAGCGTCTACGCACATATMTG[A/T]AGTTTGTTTTCGTGCGTGAACCCTTYGAGAGATTAGTCTCTGCCTATCGC
Associated Phenotype:
Not determined