Busch Lab

ZMP

adcyap1a

Ensembl ID:
ENSDARG00000004015
ZFIN ID:
ZDB-GENE-020809-4
Description:
adenylate cyclase activating polypeptide 1a [Source:RefSeq peptide;Acc:NP_690841]
Human Orthologue:
ADCYAP1
Human Description:
adenylate cyclase activating polypeptide 1 (pituitary) [Source:HGNC Symbol;Acc:241]
Mouse Orthologue:
Adcyap1
Mouse Description:
adenylate cyclase activating polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:105094]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27110
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012070 Nonsense 58 199 3 7
Genomic Location (Zv9):
Chromosome 7 (position 75238217)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 71309205
GRCz11 7 71550346
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGGAAACTCATTAACGGATGTAACATTTGACAGTGACCAGATCACTATA[C/T]GAAGCTCTCCTACAGTCACTGAAGACGCATACACGTTATTTAGTCCTCCA
Long Flanking Sequence:
CCTGACATTATGATCATAAATAATCTCATAATTTAGGCTATATCAAATCTAAAATAAGCTTTAAAATGATCACGAATCAATCAGTTAATCATATTTGGTTCTCATTAGCAGGATAAACTCATATTTAAAGTCTAGTCACTTATTTCTAAATTCTAAGAAACTCTAATAGTCTCATTTCTATTGGACTTCATTCAACGAGTGTGTTAAAACCAGTTTACACAGACGAAAGGGAAACGATAAGTCATAATATATCCATTTTGGGGACATATTTGTTGAATTATCTATAATAGCCTAATATATGCATTTTAAATATTTAATGCAAGGCCTTAATTAGTTGAAACTAAAAGTGCAGTCAGCTAGATCTATTTCACATTAATAGCTAAAGTAACTTTTACAAATGAAATGCCTTGATGTCTTGTTCTAGAATGGAGACTGCAGGATTTGATGAGGAGGGAAACTCATTAACGGATGTAACATTTGACAGTGACCAGATCACTATA[C/T]GAAGCTCTCCTACAGTCACTGAAGACGCATACACGTTATTTAGTCCTCCATCAAAAAGGTGATCTTCATACTTTACCTCCACACTCCCATTGCAGGCATGTTTATCATTGTAATCGGTCAGGTCTGTTTTTCTGCGTTAAGGCATTTGGTGCACCTGCTGATTTATGCAAAGACATGAACTGGAGAGACTGAAAAGTCATGACAACTGTGATGTTCTATTAGATGACAGATATTAATTTTGCATCTCTACGTGTTTGTACAATCTGCCGTTTTGTCGCGCAGACTGGAAAGGCACGCTGACGGGATGTTTAATAAAGCCTACAGGAAAGCGCTCGGCCAGTTATCCGCGAGGAAGTACCTGCATACACTGATGGCAAAACGTGTTGGGTAAGAAAGACTATATCTTCATCTTAATCTCTCTCTCTCTTACTTATCCATTATATGTCTTAATTTATCTTATAGGTCTTTGTTTACATTAGACTATGCTTTTTCGAATGTTA
Associated Phenotype:
Not determined