Busch Lab

ZMP

syt9a

Ensembl ID:
ENSDARG00000003994
ZFIN ID:
ZDB-GENE-031002-18
Human Orthologue:
SYT9
Human Description:
synaptotagmin IX [Source:HGNC Symbol;Acc:19265]
Mouse Orthologue:
Syt9
Mouse Description:
synaptotagmin IX Gene [Source:MGI Symbol;Acc:MGI:1926373]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa36671 Nonsense Mutation detected in F1 DNA Not yet available
sa8953 Nonsense Mutation detected in F1 DNA Not yet available
sa23320 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36671
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018685 Nonsense 86 547 2 7
Genomic Location (Zv9):
Chromosome 18 (position 28252930)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 29026282
GRCz11 18 29005418
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCGTTTCCCTGTTTGTATCATGGAAATTGTGCTGGATTCCATGGCGCGAA[C/T]GAGGCCTCTCTCCAGGCACCAAGGAGGGACATCCAGACCCCCCTCATCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8953
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018685 Nonsense 242 547 3 7
Genomic Location (Zv9):
Chromosome 18 (position 28249945)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 29029267
GRCz11 18 29008393
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGCTGAYAGGCATGAGTCWGGGCCAGCTGAAACCAGAACTCTACAAACAA[C/T]GATCCCTTGATGGYGAAGACAGTCGAAGCAGTCGTGTGGGCAGCTGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23320
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018685 Nonsense 297 547 3 7
Genomic Location (Zv9):
Chromosome 18 (position 28249780)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 29029432
GRCz11 18 29008558
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCAAGACCTCCCTGCCAAGGACTTTTCTGGAACCTCTGACCCATATGTT[A/T]AAATCTACCTTCTCCCAGACCGCAAAACTAAGCACCAGACCAAGGTGCAT
Associated Phenotype:
Not determined