Busch Lab

ZMP

fhl2b

Ensembl ID:
ENSDARG00000003991
ZFIN ID:
ZDB-GENE-041010-121
Description:
four and a half LIM domains 2b [Source:RefSeq peptide;Acc:NP_001006028]
Human Orthologue:
FHL2
Human Description:
four and a half LIM domains 2 [Source:HGNC Symbol;Acc:3703]
Mouse Orthologue:
Fhl2
Mouse Description:
four and a half LIM domains 2 Gene [Source:MGI Symbol;Acc:MGI:1338762]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa20673 Essential Splice Site Available for shipment Available now
sa20672 Nonsense Available for shipment Available now
sa141 Nonsense Available for shipment Available now
sa26710 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa20673
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003898 Essential Splice Site None 279 1 7
ENSDART00000124132 Essential Splice Site None 279 1 6

The following transcripts of ENSDARG00000003991 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 15001238)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 14974470
GRCz11 6 15101410
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACGCATAGCACATCACATCACACCACTCCTCTCCTCTCCACGGGACAGG[C/A]AAGTTAAGCATCGCAACAATTATAACCTCTTCTCTTCTCTTCTCTTCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20672
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003898 Nonsense 70 279 3 7
ENSDART00000124132 Nonsense 70 279 3 6

The following transcripts of ENSDARG00000003991 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 14984259)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 14957491
GRCz11 6 15084431
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCTGTCTTATAAAGACCGGCACTGGCACGACGACTGCTTCCACTGCTTC[A/T]AATGTCACCGTTCTCTTGTGGACAAGCCATTTTCTACCAAGGACGAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa141
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003898 Nonsense 97 279 3 7
ENSDART00000124132 Nonsense 97 279 3 6

The following transcripts of ENSDARG00000003991 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 14984176)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 14957408
GRCz11 6 15084348
KASP Assay ID:
554-1340.1 (used for ordering genotyping assays)
KASP Sequence:
TCTACCAAGGACGAGCAGCTACTGTGTACCGAGTGCTACTCCAATGAGTA[T/G]TCCTCTAAATGTTTCGAATGCAAGAAGACAATCATGCCAGGTGAGTGAAC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26711
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003898 Essential Splice Site 167 279 4 7
ENSDART00000124132 Essential Splice Site 167 279 4 6

The following transcripts of ENSDARG00000003991 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 14980594)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 14953826
GRCz11 6 15080766
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCCGTGCTACGAGAAGCAGTTTGCTCTGCAGTGTGTGCAATGCAAGAAG[G/A]TAACAGCTGGAACACAACTTGACACGTTAAATATGTAAAAAGTAATAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26710
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003898 Nonsense 181 279 5 7
ENSDART00000124132 Nonsense 181 279 5 6

The following transcripts of ENSDARG00000003991 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 14980134)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 14953366
GRCz11 6 15080306
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCACTCTCAGCCAATCACCACCGGGGGCGTGACCTATCACGACCAGCCCT[G/A]GCATAAAGACTGCTTCCTGTGTACTGGCTGTAAGCAGCAGCTGTCTGGCC
Associated Phenotype:
Not determined