Busch Lab

ZMP

crhr1

Ensembl ID:
ENSDARG00000003989
ZFIN ID:
ZDB-GENE-081231-1
Human Orthologue:
CRHR1
Human Description:
corticotropin releasing hormone receptor 1 [Source:HGNC Symbol;Acc:2357]
Mouse Orthologue:
Crhr1
Mouse Description:
corticotropin releasing hormone receptor 1 Gene [Source:MGI Symbol;Acc:MGI:88498]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa2110 Essential Splice Site F2 line generated Not yet available
sa19989 Essential Splice Site Available for shipment Available now
sa26049 Nonsense Mutation detected in F1 DNA Not yet available
sa11535 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2110
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111751 Essential Splice Site 57 431 2 13
Genomic Location (Zv9):
Chromosome 3 (position 21970933)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 21627324
GRCz11 3 21757872
KASP Assay ID:
554-3008.1 (used for ordering genotyping assays)
KASP Sequence:
ACTTTAATCCTGTGGAACCAGACATCTAGTCCAACCACTAACTCTACAGG[T/G]CAGTTTAAAACTTGTCTTTATAATCTGTAATCATGACAGATTTAAAACTG
Long Flanking Sequence:
CCATAATTCCCCATAACATCTAATTTAGCTAATAACACAGACATATTGCACACTGCACAACCAGCAATATCACCTTTTTCTCCTTTCAGCTTTATTTACACAAATAGGATCTCCAGGCTTTGATTTATTGACAGTGAAAAGCAAAGAAATATGTGCTGTTAATGAAATCTGAGGGCAGTTCATGTTGAGATGAAAGAACAAGTGAATGTGGGAGTGTTTGTAAATGTCACACTTTCAGCCAGGATTGTCATCATCCTCTTGCTATTGAGCAAATATGAGGTGTTACAAGTCATTAAGGTATTGCACTCAGCGGGCTCTTGGAGTGTATTATATGTGTAAGAAGCACTGCAGTGTATTTCTACGCAATAAATGTTGAAAAAAATTATTTTACTTGTTCTTTTACTTTTCATTAACAATGAATATTCTTTTTCTTCTTCTTCCCCAGCTCGCACTTTAATCCTGTGGAACCAGACATCTAGTCCAACCACTAACTCTACAGG[T/G]CAGTTTAAAACTTGTCTTTATAATCTGTAATCATGACAGATTTAAAACTGAATCACAGTGCTGAAGCACGTGGTCATGGTTATGACATTTCCAGGAAAATATTCGAGAGTATTTACTGTAGGCTTTGAGCATGTGAAGTTATTACTTACTGTAATACTCTGTAGAACATTTGTCCATGATGTCATGCATTAAAGATTTGTCCTTTATCCGGTAGCACATTTTTAATTTAAAAGATGATGTATGAGTTTCCCAGTGCTGGGTTGCAGCTGGAAGGACATCCTTTGCATAAAACATATGCTGGAATAGTTGGCGGCTCATTCCGCTGTGGTGACCCCTAATAAATTAGAGACTAAACTGAAGGAAAACGAATGAATGCTAATGATGTATGAAGTACTATGGATAAATATAAATGGACAATTAATAGATGTCACAAACAGCCTCTGCCTTTGGTTGGTCGAGTTGATGATCCTAAAGATCATCATTTGGTCATTTTGCTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19989
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111751 Essential Splice Site 161 431 6 13
Genomic Location (Zv9):
Chromosome 3 (position 22064425)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 21720816
GRCz11 3 21851364
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTGTTCCCTCCTTTGCATCTTTGGCCTCCTCCATCTTTCCTTCTCCCA[G/T]GAGTATCCGGTGTCTGAGAAATATCATCCACTGGAACCTGATTACAGCAT
Long Flanking Sequence:
TTGTTTTTTTTTTTTTTTTTTTCAGCAGACATCATTTCAGAGTGAGTAAATGATTGTGTTTTTTTTTTTTGACCATACAATAATATTTTTATTCATTTACCTATTTTTATTCAGAATCAAATTGGTTTAGTCTTTCTAATTAACAGTCACACAGTGTAATTTGCTAACCTTTTCAATGAACTGACATCAATTACATTTAGGCATATCATAGGTGTGCCGAATATGAAATGCACATTACTTGAAGATACAGCCACTCTACGCAGTCAGTGTGCCATTTAAAGATAAACATAATGTGCTCTGATGGGACTGCATGCTGAGGAAACTCGATGACACAATGGATCTACCAATAAAACAGCATGAAGCCTCGCTGCGAGCGCATTCAAACCCTGTGAAAATGACAACAGAAAAAGTCTCGATGAGCAGAGGGTTTTCATCTAACGTCTTAACTCTTTCTGTTCCCTCCTTTGCATCTTTGGCCTCCTCCATCTTTCCTTCTCCCA[G/T]GAGTATCCGGTGTCTGAGAAATATCATCCACTGGAACCTGATTACAGCATTTATCCTGCGAAATGCCACCTGGTTCGTGGTTCAGCTCACCATGAATCCAGAGGTGCATGAGAGCAATGTGGTGAGTAAACAAACATTCTCTGCTTCTCTTGTTTCTTTGCCTTTCAAAACACACAACAGCGCACGCACAAACTGTTGTTCAATCTCACAATGCACACACAACCTCTCTTTTATTCCATCCATTCTTCATTCGCACTAATTCTCTCTTATTTCGCCCCCCGTCAGTGTTATTATGTTGGCACACATGCAGGGAAACACAAGTTTATTAATTGCATTCAAAAGCTGTCCCCAGCACCTGCGGTCTCTGTTTCTGCACTCTTAACGGATGTGGAAATCTAACTACTTTGAGATTGTATGCCACTGTTGGCACTGGATGTGTGTGTTTGGGAGGGAATACAAACAGCTTACCGTCCACTGTTATGCAGAGAATTAATTACCCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26048
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111751 Nonsense 167 431 6 13
Genomic Location (Zv9):
Chromosome 3 (position 22064442)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 21720833
GRCz11 3 21851381
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATCTTTGGCCTCCTCCATCTTTCCTTCTCCCAGGAGTATCCGGTGTCTG[A/T]GAAATATCATCCACTGGAACCTGATTACAGCATTTATCCTGCGAAATGCC
Long Flanking Sequence:
TTTTTCAGCAGACATCATTTCAGAGTGAGTAAATGATTGTGTTTTTTTTTTTTGACCATACAATAATATTTTTATTCATTTACCTATTTTTATTCAGAATCAAATTGGTTTAGTCTTTCTAATTAACAGTCACACAGTGTAATTTGCTAACCTTTTCAATGAACTGACATCAATTACATTTAGGCATATCATAGGTGTGCCGAATATGAAATGCACATTACTTGAAGATACAGCCACTCTACGCAGTCAGTGTGCCATTTAAAGATAAACATAATGTGCTCTGATGGGACTGCATGCTGAGGAAACTCGATGACACAATGGATCTACCAATAAAACAGCATGAAGCCTCGCTGCGAGCGCATTCAAACCCTGTGAAAATGACAACAGAAAAAGTCTCGATGAGCAGAGGGTTTTCATCTAACGTCTTAACTCTTTCTGTTCCCTCCTTTGCATCTTTGGCCTCCTCCATCTTTCCTTCTCCCAGGAGTATCCGGTGTCTG[A/T]GAAATATCATCCACTGGAACCTGATTACAGCATTTATCCTGCGAAATGCCACCTGGTTCGTGGTTCAGCTCACCATGAATCCAGAGGTGCATGAGAGCAATGTGGTGAGTAAACAAACATTCTCTGCTTCTCTTGTTTCTTTGCCTTTCAAAACACACAACAGCGCACGCACAAACTGTTGTTCAATCTCACAATGCACACACAACCTCTCTTTTATTCCATCCATTCTTCATTCGCACTAATTCTCTCTTATTTCGCCCCCCGTCAGTGTTATTATGTTGGCACACATGCAGGGAAACACAAGTTTATTAATTGCATTCAAAAGCTGTCCCCAGCACCTGCGGTCTCTGTTTCTGCACTCTTAACGGATGTGGAAATCTAACTACTTTGAGATTGTATGCCACTGTTGGCACTGGATGTGTGTGTTTGGGAGGGAATACAAACAGCTTACCGTCCACTGTTATGCAGAGAATTAATTACCCTCCGCATTTCTGTGCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26049
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111751 Nonsense 228 431 7 13
Genomic Location (Zv9):
Chromosome 3 (position 22072943)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 21729334
GRCz11 3 21859882
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATTATTTCCATGTGACCAATTTCTTCTGGATGTTTGGAGAAGGCTGTTA[T/A]CTGCACACTGCCATAGTATTGACATACTCTACAGACAAACTGAGGAAATG
Long Flanking Sequence:
TAATTTGGCATTGACCAAAACTGTAATACATCCTACAGCAAGAGCAAGTACTGTGCTCCTCATATTCCTGTCATGTGAAGCCACAACTCAATGGCTTTCATCATGTTTTCATCTAAATCTGTTCCAACCTGGGGCCTCGTTTCAGATCTCCATCCCATTCACCCATCTGCACCATCCCTTCCCTCAAACTAGAAAGATTTTATCCCCTGCTTGGTGTGTTTGAACTTGCTTCAGTCATAAAGAGTAGCTCTTCCTCACACACACACGTGCACACACCAATAAGCTTTCATTTCCTTAAGCTATTAAAATAAAAGCTTTTAAAACAGAGACGTCTAAGCAGAAGTGGCATGGCGATTTCCGCAGGCACAGTTAAGGAGAGTTTCTAAAACATCTAACTGGATTTCTCTCTCTCTCTCTCAGATCTGGTGCAGGCTGGTCACAGCGGCGTATAATTATTTCCATGTGACCAATTTCTTCTGGATGTTTGGAGAAGGCTGTTA[T/A]CTGCACACTGCCATAGTATTGACATACTCTACAGACAAACTGAGGAAATGGATGTTCATATGTATAGGCTGGTGTAAGTATTCCAACATGTTCTGTTATTTGATCCAGATATACATTACTGGTCAAACGTTAGTTCAAACGGGATCAGTGAGAATTAAAAAATATATATTTAAAAAAAGAAGTCTCTATTCTGCTTACCAAGGCTGCATTTATTTGCTATTTAAAATATGTTTTCCTATTGAATGTAGTTTAATTTATTAAAAGAACGTTTAGTATGTACATTTCATTTATTCCTGTGATTTAATGCTGCATTTCAGCATTGTTTTTGCAGTTTTCAGTGTCAGATATGTTTGTATAAACTGTGACAGTAATAAAATGCCATTTTAAAAAGGCTTTTATTTAACAAGAATACAATAATTTGCTCAAGACTGAAAGCAAATGCATACAAGAATTAGTCAGAATTAGTAGCCATTCTCAATTATTAGCCCCCTGTATATAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11535
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111751 Nonsense 288 431 9 13
Genomic Location (Zv9):
Chromosome 3 (position 22077624)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 21734015
GRCz11 3 21864563
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCAGGTGCTGGTTTGGGAAGCGAGCCGGCATTTACRCWGATTATATTTA[T/A]CAGGGTCCCATGATCCTGGTYCTACTGGTGAGTCAACAGAATTTAGATTC
Long Flanking Sequence:
AATCGGTGTGTTTCTTTGCTTGAGTTTCACAACTGACAGCACTTTCTCATTCAGACATATTCCCAAAAGCCACATGTCTCCCTTCGTGCAAAACTAACACACTCAGCCGAGACAGTCTTCATTATGCTGTGTACCCAACTGAAACTTTAAGATTAACAAATCTGGTGCACATCTACCCAAGGGACACACTTTCCTTCACTTTTTTTTTGTTTTGTTTCTTTTGTTTTATACATGTAAAAGCTTCTTTTGGATATATATTTTTGAGAAATTTCTGGATTCACTTTACTAGACTTGTTTGTTTAATCATTGTGCTATAAATATCCACCTCAGAATCCCTTTATATTGTTACACGGGTAAACAGTCGAGTTGTATCTGGAGAAATGGGGTCAACATATTATGTATTCTGCACATTAATTTTCACTGGTGAAGCAAGAGATCCTTGTCTTTCTGTGCAGGTGCTGGTTTGGGAAGCGAGCCGGCATTTACACTGATTATATTTA[T/A]CAGGGTCCCATGATCCTGGTCCTACTGGTGAGTCAACAGAATTTAGATTCATATTCAATTACACAAATGTTTCTTGAGATCTGGTGTGTGCAGGCCATTTAGCTTCCTCTATTAAAAGAGATCTGTTTTTTTTTTTTTTTTTTATAGTTACGTGTGTAGTTATGGCATTACAGTGTGTGTCTTTTCTGTTTTCTCTCCATTTTAGATTAACTTCATTTTTCTTTTCAACATTGTGAGGATCCTGATGACTAAACTGAGGGCCTCCACCACGTCAGAGACCATTCAGTACAGGTGAGACCACTGAGTCTTCAGCACAGACAGAGCCTTTCATTCATTTATTTAGTTCTGTTCTTTGTTATTGCAGCAGAAATATGTACTTTGGTTTTCTTTTATGAAATATTCATTTTATTTGACTAGGCAGCGACCAAACAGAATATAGTACTTAAGCTACAGTTCAAAAGTTTGAGGTTGTTTTTTTGGATTTGCATCTAAATTATTAA
Associated Phenotype:
Not determined