Busch Lab

ZMP

zgc:114108

Ensembl ID:
ENSDARG00000003973
ZFIN ID:
ZDB-GENE-050626-79
Description:
cysteine and histidine-rich domain-containing protein 1 [Source:RefSeq peptide;Acc:NP_001020346]
Human Orthologue:
CHORDC1
Human Description:
cysteine and histidine-rich domain (CHORD)-containing 1 [Source:HGNC Symbol;Acc:14525]
Mouse Orthologue:
Chordc1
Mouse Description:
cysteine and histidine-rich domain (CHORD)-containing, zinc-binding protein 1 Gene [Source:MGI Symbo

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa9389 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28539
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041249 Nonsense 180 339 7 11
Genomic Location (Zv9):
Chromosome 15 (position 42765956)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 43943967
GRCz11 15 43967410
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATTATTAGACATACAACGGACCAAAGACCGATGAAGAGATGTGTTTATA[T/A]CATTCTGGAGTTCCCATTTTTCATGAGGGGTGAGCAGAACGCAGAAATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9389
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041249 Essential Splice Site 264 339 9 11
Genomic Location (Zv9):
Chromosome 15 (position 42761832)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 43939988
GRCz11 15 43963431
KASP Assay ID:
2260-8997.1 (used for ordering genotyping assays)
KASP Sequence:
AAAAAACTCCAACCCGCAGCTCTGCTCTGTGGAGGCCAACAGCGTCTCGG[T/G]CAGTGTGTTTATCTGATTAAAGAGATWATTTYTTTCTAAAYGTGCWAAAA
Associated Phenotype:
Not determined