Busch Lab

ZMP

cx28.6

Ensembl ID:
ENSDARG00000003925
ZFIN ID:
ZDB-GENE-040406-4
Description:
connexin 28.6 [Source:RefSeq peptide;Acc:NP_001007213]
Human Orthologues:
GJB4, GJB5
Human Descriptions:
gap junction protein, beta 4, 30.3kDa [Source:HGNC Symbol;Acc:4286]
gap junction protein, beta 5, 31.1kDa [Source:HGNC Symbol;Acc:4287]
Mouse Orthologues:
Gjb4, Gjb5
Mouse Descriptions:
gap junction protein, beta 4 Gene [Source:MGI Symbol;Acc:MGI:95722]
gap junction protein, beta 5 Gene [Source:MGI Symbol;Acc:MGI:95723]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa42890 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa42890
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012889 Nonsense 234 251 1 1
Genomic Location (Zv9):
Chromosome 17 (position 14553731)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 14704559
GRCz11 17 14712492
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGGACCAGCACAAAGATCCAAAACACATGATCCAACTCTTTCAAGCAGA[C/T]AGAACTTAATTTCACAAAAAGTAAAAGAGAAAAAAATAGACAATACAGCT
Associated Phenotype:
Not determined