Busch Lab

ZMP

zgc:153454

Ensembl ID:
ENSDARG00000003910
ZFIN ID:
ZDB-GENE-030131-3529
Description:
Mediator of RNA polymerase II transcription subunit 13-like [Source:UniProtKB/Swiss-Prot;Acc:A2VCZ5]
Human Orthologue:
MED13
Human Description:
mediator complex subunit 13 [Source:HGNC Symbol;Acc:22474]
Mouse Orthologue:
Med13
Mouse Description:
mediator complex subunit 13 Gene [Source:MGI Symbol;Acc:MGI:3029632]

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa22623 Nonsense Available for shipment Available now
sa22622 Nonsense Available for shipment Available now
sa35864 Essential Splice Site Available for shipment Available now
sa28439 Nonsense Available for shipment Available now
sa12757 Nonsense Available for shipment Available now
sa30993 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa32028 Nonsense Available for shipment Available now
sa35863 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28440
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110267 Essential Splice Site 22 2102 1 30
Genomic Location (Zv9):
Chromosome 15 (position 19086176)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 20188802
GRCz11 15 20124534
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCCAACGGGGCGAGCCTGGAGGACTGCCACTCCAATCTATTCTGTCTGG[T/A]AAGAGATCAACTGACTGTGGGCCAGAAGCCATTTTTAGCCGGCCAGTCAA
Long Flanking Sequence:
GAAGAGGAGAGTGTGATTTTAGCGAGATTTACAGCTGAACTCTTCTGTCTTGAACTGTTTGTTGCTGCCTCGCTTAGCCAAGGCTAACATCCAGCTAGCCTGATGCTAGGCTAAGCTAAAGGGGGAGGGCTGAATTCACCTCCCTACCCCCTCGGACTGCTGTACTTGCATATTATTTAATGTAGCGAAATCCGCGGGGAGAACAGCATATCTCGCCGCGGATCATGGTAAAGTTTTTAGCGCATTTTTCTTGGTAACGTAAGCGAGTAACCTCTAGCGGAATAATAGCGGAGCTAAGCTAATTAGCTCGCTGGACGCGGAGCCGTCCTGCTGATTGTGTCCGAGACACGGAGACCCGGTCCAAAAGCCTCGATCGCATCATCTGTTCCTGGGATCTGAAAGAGAGGATGGCTCGCCGGACTGCGCTTTGATGATGAGTTCTTGTTTTGTACCCAACGGGGCGAGCCTGGAGGACTGCCACTCCAATCTATTCTGTCTGG[T/A]AAGAGATCAACTGACTGTGGGCCAGAAGCCATTTTTAGCCGGCCAGTCAATCAAACAGAGGCCTGTTGCTCTTTATACGAACTAAACACCCGCTTTATAAACGTATGTTAGGCGTTCAGGTGTGTTATGGTGTTGTGTAAACGGAGGTTTGCGTGTGGGATGCGGCTTTGTTGTGTTATTTGGGTCGTGTTTGCTAACGTTGGTAAACACTTGCTGAACTTACTGACTGGAACAAGTAGTTGGCATGAAGTATCTCTGAAGTGGAAAAACAGCTTCAGGGAAAGTGATGATGTACAACAGCAGCAGTGCAAAATCAAGACGCTGCAAGCATAACAATTGGTTATTTTGAGATTTCTTTCATAACCACTACTTTTCAGTTTTTATCTCGTCGCAAGTGTCTTTTAGTTCTCATCTACAAAACATTTTCCTCTTAGAAGGAGTCTGGATTTTTTAGTTCAGTAGCACTTGCAATGACTAAACTTTCCCAATTATATTCTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22623
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110267 Nonsense 220 2102 5 30
Genomic Location (Zv9):
Chromosome 15 (position 19062355)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 20164981
GRCz11 15 20100713
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCCTACAGTCATCCTCTCTCCGTATGGTCTGAGCGGGACTCTGACGGGC[C/T]AGTCCTTCAAGCTCTCGGATCCACCAACCCAGAAGCTAATCGAGGAATGG
Long Flanking Sequence:
AAATACAAAATGGTCATTATAAATTATTTTAGCGCTAAAAAGCATAGTTCTTTCTTGCATTAAAACTGTCCAGTTAAAATCCAAACATTTTAAACAAGGCAAAGATAAATATCCATCCATTTGCATTTTAAATTGTGCATCAAACATTTGCTAGCATTTATTAACATTAGAACTTTTTTTTTAAATCATACGATTTCCTAAATATAATCCCAACATCCATTAGCTTTCAAAAACATTTCATAACCCATTATTAAATCTATTTTTTTACTGATTTTCTATTTTATGATCTAACATGAACTTGTGCAACTCTGAAATACAGATAGATCATTTGACTGTCATTTTATGGTTACTTTTGTGGCTCTAAGCATTGTCCTCATGTTTCCACAAAGAGAACTGAGACTTTACCAGGAAGTATCATTCTTGCAATTACACTGCAGTATTTGCTATATTTTCCTACAGTCATCCTCTCTCCGTATGGTCTGAGCGGGACTCTGACGGGC[C/T]AGTCCTTCAAGCTCTCGGATCCACCAACCCAGAAGCTAATCGAGGAATGGAAGCAGTTTTATCCCATCGGCCCCAACACCAAAGAGGTCACAGACGACAAGATGGATGACCTCGACTGGGAGGACGATTCCTTAGCCGCCGTTGAAGTCGTTGTCGGTAAGACAGATATTCAGCTTTATGTATTGTGATTTCATGGTCGCCTCGAGTGATTTGGAGTGCGAGTAATAATTAATGTGATGCAGCTGGTGTGAGGATGGTGTACCCAGCCAGCCTGGTGCTGGTGGCCCAGTCAGACATCCCGCTGGTGGCTACAGTGAGCTCTTCCTCCTCCTCGGGCTCTTATGCTGGAGCTCCGCATAATCAGCTGGTCCATGGAGACACTGGCATCTCTTCAGTCACGCTGACTCCTCCCACTTCACCTGAAGAGGCACAAGCAGGTACCATTACTACTGTCTAAATTATTTCAAATGCTGTCATTCGTTAAGAATAATTAAAGTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22622
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110267 Nonsense 236 2102 5 30
Genomic Location (Zv9):
Chromosome 15 (position 19062305)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 20164931
GRCz11 15 20100663
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTCCTTCAAGCTCTCGGATCCACCAACCCAGAAGCTAATCGAGGAATG[G/A]AAGCAGTTTTATCCCATCGGCCCCAACACCAAAGAGGTCACAGACGACAA
Long Flanking Sequence:
TTTCTTGCATTAAAACTGTCCAGTTAAAATCCAAACATTTTAAACAAGGCAAAGATAAATATCCATCCATTTGCATTTTAAATTGTGCATCAAACATTTGCTAGCATTTATTAACATTAGAACTTTTTTTTTAAATCATACGATTTCCTAAATATAATCCCAACATCCATTAGCTTTCAAAAACATTTCATAACCCATTATTAAATCTATTTTTTTACTGATTTTCTATTTTATGATCTAACATGAACTTGTGCAACTCTGAAATACAGATAGATCATTTGACTGTCATTTTATGGTTACTTTTGTGGCTCTAAGCATTGTCCTCATGTTTCCACAAAGAGAACTGAGACTTTACCAGGAAGTATCATTCTTGCAATTACACTGCAGTATTTGCTATATTTTCCTACAGTCATCCTCTCTCCGTATGGTCTGAGCGGGACTCTGACGGGCCAGTCCTTCAAGCTCTCGGATCCACCAACCCAGAAGCTAATCGAGGAATG[G/A]AAGCAGTTTTATCCCATCGGCCCCAACACCAAAGAGGTCACAGACGACAAGATGGATGACCTCGACTGGGAGGACGATTCCTTAGCCGCCGTTGAAGTCGTTGTCGGTAAGACAGATATTCAGCTTTATGTATTGTGATTTCATGGTCGCCTCGAGTGATTTGGAGTGCGAGTAATAATTAATGTGATGCAGCTGGTGTGAGGATGGTGTACCCAGCCAGCCTGGTGCTGGTGGCCCAGTCAGACATCCCGCTGGTGGCTACAGTGAGCTCTTCCTCCTCCTCGGGCTCTTATGCTGGAGCTCCGCATAATCAGCTGGTCCATGGAGACACTGGCATCTCTTCAGTCACGCTGACTCCTCCCACTTCACCTGAAGAGGCACAAGCAGGTACCATTACTACTGTCTAAATTATTTCAAATGCTGTCATTCGTTAAGAATAATTAAAGTAGTGTATATGGGCTTGACTTCATTTGGGTTATATTTAATCCCTGCTTATATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35864
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110267 Essential Splice Site 390 2102 7 30
Genomic Location (Zv9):
Chromosome 15 (position 19059170)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 20161796
GRCz11 15 20097528
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGTGGAGCGAGTCTGGCAGGAGTGCAATATTAACCGAGCACAGAACAAG[T/C]AAGAATGTAAAATCTACATCATGACTGATTAGCCAGAGCAAATAACCTGG
Long Flanking Sequence:
CAATCGCAGCCCTTTCTGTCAAGCGTGTGACCAATCATAGGCGTTTAACAGCTCGCTTGACAACCCCTAAAAAGCAAACGGGATAACATTTACGTTTGCTTAAAATAATAATTTAAAATAATAATTAATATTACATATATTAATACACAATATTGTTGTTATTATTATTCATTCATTTCATTTTTTTCTATTAATGTTTTAATAGATGAATTATGTTCTATGATAAATTATGTATAACAAGACCAGTACAATCAACAGCACTTGCTCATTCTAAGTTGCTGTCAAAACCATTAGTTATGTAATGTCTTGTATGTTTTTTTTTTCTTTCCCTTGTTGCAGTCTCTCAGCCTGCCCAGAAGTGGGTAAAGCTCTCAGCAATGTCAGGCGTCTTTAGTGTGGACAGCAGCAGCCATCACGGAGGAAAGATCCCCCGCCGGCTAGCCAGTCAAATGGTGGAGCGAGTCTGGCAGGAGTGCAATATTAACCGAGCACAGAACAAG[T/C]AAGAATGTAAAATCTACATCATGACTGATTAGCCAGAGCAAATAACCTGGCAGTGAGAAATGGATTGAGTAAGAACAAAGCAAGTTCAGGCATTCGCTTTGATTTGTTTTTGTGCAGGAGAAAGTTTTCGACTATGTCTAATGGAGTTTGCGAGGAAGAAACCGACAAAGCTTCTGTTTGGGACTTTGTGGAGTCGTCTCAAAGGTCACAGTGCAGCTGCTCAAGGTATGCTCACAGGCTTCACTTTTGCAACAAAAAAGTATTTTTATTTAATAGAGACATAATTTTCATTCTACCTTGGCTTCAATGATTATTTCATCAATAGAAACCTGCCTAAAACAGAAACTATATTTAGTTCATTTAGTATATTTAGTATGCTGTGTGTGTGTTTTTGTGCTAGTCCTTGTTGGCTGTTCAGGCCTCTCATTGATAAATCAATGGTATTGTAATGTTCAGTTGGTGGTAGGCCTGTCACAATATCTATATTTTAGTGTTTGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28439
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110267 Nonsense 432 2102 9 30
Genomic Location (Zv9):
Chromosome 15 (position 19056810)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 20159436
GRCz11 15 20095168
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGATAACATTTCTATCTTTCATTTTTCATTCCAGGCTTAAAAACCAGAAA[C/T]AGCGGGCATGTAGCACCCCAGGGCATCCTCCATCTGCTGGCCAGCCTCCT
Long Flanking Sequence:
AATGATGTCAACTGACACTGTATTTACAATCTACTGTAGAGTATTTACGAGGAGATCTCAGAACTGTATTCACTGAAGCAATAAAATGAATCCCATATATTGCTTCAGCGTTTTGTTGTTTGTGATGAGCAAGTGATGAGTAAGTCACTCATCAGAGCCCAACATAAATACCTTTGATTGGACACTGCATTCATAAGATCAATAAAAACATGTGCTTGACACTATTTATTTTTACATTTAATTTTATTATCATGACTGCACTTGTAATTTATTTGAATTATTCATTTCCTCCTCATTATTTTGGACTCTAGAGCAAAAGCTAACATAATGCAAATTAGTTTTAAACCCAAACATTAAAGACTCATTTTACACATTACATGAAAGTTAAAATCCCCAAAAAAGGATAACAGAGACACTCAAACTAAAACGTGTGAACGAATAAATGCTGGTTGATAACATTTCTATCTTTCATTTTTCATTCCAGGCTTAAAAACCAGAAA[C/T]AGCGGGCATGTAGCACCCCAGGGCATCCTCCATCTGCTGGCCAGCCTCCTCAGCCCTCTACCAAACACAAGATGGCGGAGAAGCTGGAGAAGGGGGACAAGCAGCAGAAAAGGCCGCTGACGCCCTTCCACCACCGCAGCTCTCTGTGTGAAGAACAACCCAGCTTGGAGCAGGGAGAGAGCGTTCACCGACTGTGTCTGCAGGGTCATGAGGACAGCAGGTATCCCAGCCTCCACCACGCAGACGTCACCTCCAGCAAGACGCCAATGCTCCACAGCTCTGCGGATGAGATGGCAGGCTCCCCTCAGCCGCCACCGCTCAGCCCGCACCCCTGTGAACGTATGGAGGAACCAGCCGATGGCATGAAGAGTTCATCCTCACCCCTGCACCAACACTTTTACCCTCCTTCCTCTGAGCCCTGCCTGGAGCCCCAGAAACCCCCAGATGAATCCACATTAGACCCATTGCCCTTACCATGCCCACCTCCATACCCAGAGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12757
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110267 Nonsense 484 2102 9 30
Genomic Location (Zv9):
Chromosome 15 (position 19056654)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 20159280
GRCz11 15 20095012
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGAAAAGGCCGCTGACGCCCTTCCACCACCGCAGCTCTCWGTGTGAAGAA[C/T]AACCCAGCTTGGAGCAGGGAGAGAGCGTTCACCGACTGTGTCTGCAGGGY
Long Flanking Sequence:
GCCCAACATAAATACCTTTGATTGGACACTGCATTCATAAGATCAATAAAAACATGTGCTTGACACTATTTATTTTTACATTTAATTTTATTATCATGACTGCACTTGTAATTTATTTGAATTATTCATTTCCTCCTCATTATTTTGGACTCTAGAGCAAAAGCTAACATAATGCAAATTAGTTTTAAACCCAAACATTAAAGACTCATTTTACACATTACATGAAAGTTAAAATCCCCAAAAAAGGATAACAGAGACACTCAAACTAAAACGTGTGAACGAATAAATGCTGGTTGATAACATTTCTATCTTTCATTTTTCATTCCAGGCTTAAAAACCAGAAACAGCGGGCATGTAGCACCCCAGGGCATCCTCCATCTGCTGGCCAGCCTCCTCAGCCCTCTACCAAACACAAGATGGCGGAGAAGCTGGAGAAGGGGGACAAGCAGCAGAAAAGGCCGCTGACGCCCTTCCACCACCGCAGCTCTCTGTGTGAAGAA[C/T]AACCCAGCTTGGAGCAGGGAGAGAGCGTTCACCGACTGTGTCTGCAGGGTCATGAGGACAGCAGGTATCCCAGCCTCCACCACGCAGACGTCACCTCCAGCAAGACGCCAATGCTCCACAGCTCTGCGGATGAGATGGCAGGCTCCCCTCAGCCGCCACCGCTCAGCCCGCACCCCTGTGAACGTATGGAGGAACCAGCCGATGGCATGAAGAGTTCATCCTCACCCCTGCACCAACACTTTTACCCTCCTTCCTCTGAGCCCTGCCTGGAGCCCCAGAAACCCCCAGATGAATCCACATTAGACCCATTGCCCTTACCATGCCCACCTCCATACCCAGAGACACTAGAGGCCACCATATACGTGGGCTCAGCCATAAACCCCAATGAAGATACGACACATAACCCCTGGAAGTACTTTAGGGTGCCTGGTGGGAGGAATTCAGATTTCCACACACCTCATCTTCCTGTGGTTGCGCACTTTGAGGATGGGAACAGGACT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19107
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110267 Essential Splice Site 783 2102 12 30
Genomic Location (Zv9):
Chromosome 15 (position 19049881)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 20152507
GRCz11 15 20088239
KASP Assay ID:
2260-8347.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCATTAATGACCTGGACAACCTTTTTAACTCTGACGAGGATGACCTTACG[G/T]TTAGTAGCCACTACTTACATGCACACTGTGACGTTTGTTGTAAAAAGTGA
Long Flanking Sequence:
TGAAGAGCTGGTGAAGATGTACGAGCATAAGAAAAACCAGTATCTATCATCGGCTGTGTGTGATGAAGATCCAGAGCAAGAATCTGATCCTTACGCTTTTGAGGAAGGAGATGAGGAGTTTAATTTCTCAGATAAAGATAAAAAGTCTGGATCAGAGAGAGAGGCTGGGAAAAAAGCTAAGGTCAGACAGTGATTCTTTTAGAAGAATGTTGAGTCAAATGAACGTTTTTATTGATTACAATATTTCTTTGCTTGACTTTTAGAGGGAAGATGGCAGTTCATCTTCTGATGGTGAGTGGAATTCCCTGGCATGTTATTTCTAAAATAAAATGTTTTAGTGTTTCTGAGGTTCATCTTGAACATTTGTTGTTTGCGCAGATGCCCAGGGTTCAGGTGGTAGTAAACCACTTCCTACAACCAGCTTGATCCATGAGACCGATCTGGTCGTGTCCATTAATGACCTGGACAACCTTTTTAACTCTGACGAGGATGACCTTACG[G/T]TTAGTAGCCACTACTTACATGCACACTGTGACGTTTGTTGTAAAAAGTGAAAAAAGTTTAAAGACTTTTTCAAAGTCACATGAATTGTTCAGGTGTGAGCTTTTCCACAGACTTCAACAGAATGTAAAAATCTTAATGATTTTGTGGGTCTCCTCTTTCAAATCTGATCTTTAATTTGTTTTCTCTATTGGATTCAAATCAGGTGATTGGCTAGGCCATTCTGCAGCTTATTTTTCTTTCTTTGATAGCATTTGAGAGTTTCCTTCGCTTTGTTTTGGATCGTTGTCTTGCTGAAATGTCCACCCTAGTTTCATCTTCATCCTCCTGATAATGTAGATGTTGCAATGAAGCAGCTAATATTAATTTACACTGACAGAGTTATTACACATAACTTAATTTGTAAACTAATTGATATTGTTTTCTTTGCATATATGAATTTCTTTAGTTGTTACCAACATCCAGGGAAAATTTCAAGTCAACGACACCTTTAGAAATAAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30993
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110267 Essential Splice Site 1373 2102 19 30
Genomic Location (Zv9):
Chromosome 15 (position 19036281)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 20138907
GRCz11 15 20074639
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTATAAAAGACTATAGAAATAAATGTGACTTGATTGATTATTGTTTGGCA[G/A]TCTTGTCGGCTTGGTCAGCACAGGCCCATTGCCAAGTCTCACGCTGATGG
Long Flanking Sequence:
AGTAATTTAATAAGTAATCCAATAAATTGGCTAATAAATCATTAAAATGTAAAGTTTGACATCAGCCTGATTTGGAAAATGATATACTGGTGCGATGCACTGTACAATTTGACAAATAAAATGAATGTAACTTAATAATATTAAAATACTTCTGTTTATGAATTAATAAAGCAGAAGAAATTTTTGATAATAATGGTGATAATACATTTTATTTGGGCCACATGAAGTTGCTATGTTTTTTTTTCCTGTTTTTATATTCTATTATAAGTTGGATACTTTTCCGTTTTATCCATATACAAACTCATACAGGCAATAAATACTATATAGCATAGCTTAACTGAATAATAGCTTGTCTCATTGCAACGTGTAAACTACATCATCACCCAGTTCAGCTTAATTAAGACACTTTAAACATTATTTTATGTAAAGCTGCTTTGAAGAAAATATGTTGTATAAAAGACTATAGAAATAAATGTGACTTGATTGATTATTGTTTGGCA[G/A]TCTTGTCGGCTTGGTCAGCACAGGCCCATTGCCAAGTCTCACGCTGATGGCATTGTGACAGTGAGCGATGCTGGATCAAAAGCTCTTACTGATCAGACTCTCATCGACTGGCTTCCAAAAACCATCAACAGCAGCAGCAGCAGTGAGGCTTTAAACAAGCTCAAACTCTACGCCCATGTGTGCCGACATGACTTGGGTATGTGCAGAAACTGAATGTTCTTTGATGTACTGCAGACCACATCGATAAATGTAAAGTTTCTATAATATTTAATGTCTCCTCAGCATCCTGTCTGGCTTCCCAGTCATTGGACGGCTCACTTCTTACCCAGCGAAACCCAGCCAGCTCTTCGCAAACTTCCAGTTCCAGCAGCCCAGTCACAACCGCACAGAATGTCACCCCAACCACCAACAGCAACAGCAACACCAACACTAACACCACTCCGACCTCCACTTCCACCTCCAGCAGCTCTTCCTCTTGTCCTCAGGGCGTAGGCAACATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32028
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110267 Nonsense 1652 2102 22 30
Genomic Location (Zv9):
Chromosome 15 (position 19032998)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 20135624
GRCz11 15 20071356
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCAGTACTTGCTGCAGCCGGTCTGGAGTGAGGAGCGCCATATATATGCA[C/T]AGCACCTGAAGTCTTTGGCTTTCTCAGTTTACACACAGTGCAGACGGCGT
Long Flanking Sequence:
TAATTTCCCTTTCTAAGCACTGTAGTTCATTTCTAATGGCCAGACTGCTTTACTACTGATGGTTTTTTGATGAATAATGTTGGTTCTTTTCAGATGTTTCCTCTAATCTATGATTTTTTCCGTCACAGTACGATGGAGAGAGAAAAGGTTGGGGTCCCGACTGATGGAGACTCTCATGCAGTCACCTATCCTCCTGCCATAGTGATCTACATCGTGAACCCCTTCAGCTATGAGGAAAACTGCCAAGGCAGCAGTTCCAGCGTGTGGACGATAGCTCTTCTTCGCTGTTATCTGGAGATGCTTCAGCTTCTTCCTCCACATATCAGGAATGCTGTATATGTCCAAGTAAAAAGACATCGAATATGAGATTACTTTTTCCCCCTACTATTTCCTCTTTGCTTGGATCATCTGAACATTCTGTGTATTTTTTTTTCTATTAGATAATTCCCAGTCAGTACTTGCTGCAGCCGGTCTGGAGTGAGGAGCGCCATATATATGCA[C/T]AGCACCTGAAGTCTTTGGCTTTCTCAGTTTACACACAGTGCAGACGGCGTCTGCCAACCTCTACTAATGTCAAAACGCTAACAGGTTTCGGCCCCGGCCTGGCAATCGACACTGCACTACAGAGCAAAGAGGTACACATGATAATTGCCAGCATCGCAGGCAAATGGGCTTTCAAACTGGTGTGCTTGAAGTGTTTGTAAAAGTAGCATCTATTCAAGCATTTATACAAGGTTTACCAAAATTTTTATTCGAAATTTAAACAAATCTGTGCCAAATGTGGTGTTTCTTTCTTTATAAAGATAAAGTAGGTGTCCACAAGGGAGATCAATATTGTCACTGGAAAAATTATATTAGAAAAAAAAGATTTTAATAAGAGCATGTTTGATTATTTATTTACTTTGTAATAAATGTCATAACTGGTAAATTTGTATTGAAATGTTATTTTCTTAATAAAAAAATAGAAGGGAGGTCTGAGGAAAATTAACAACATACTTGTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35863
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110267 Essential Splice Site 1870 2102 25 30
Genomic Location (Zv9):
Chromosome 15 (position 19028495)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 20131121
GRCz11 15 20066853
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACCTGTCTAGTTGCCATGGAACCACAGGCTTCCTTTGTAATCATGCCAG[G/A]TAATTAATGTGGCGCTTTCACACAGAGCACTTGTACTTTGTCATTGTTCA
Long Flanking Sequence:
TATCTGAAACGCATTAAAAAGAAACTGTGTAAAACAGTGTCATAATAAATAAAAATATAGTTAAAATCACATAATTTTGTTCATCACATAGTTATCCATTTGTGTGCTGTGGGTAAAAGGTGTGTTTCAAACTACTGAACAAAATGACTTTACTCCTGAATGATTCATTCCTTCCAAATGTGCAGTAGCTGTTCAATTCATTATTATTATTTTTAATATTATTATTATTATTTTTAAATTGTAAAATAAAACAATGTCAGTTATTCCTGAAATCTTACAGCTCTTGTCTGGTAGCACATGTCCTAGCTTATTGGTCTAACTGCTGTTTCTGTCTCAATCAGATTGGAGTATTCTGTTGAGTAGGCGGAACCTGCAGTCTCTCGGCAGACGACTGAAGGAAATGTGCAGGATGTGTGGCATCTCTGCCGCCGACAGTCCCAGCATCCTCAGCACCTGTCTAGTTGCCATGGAACCACAGGCTTCCTTTGTAATCATGCCAG[G/A]TAATTAATGTGGCGCTTTCACACAGAGCACTTGTACTTTGTCATTGTTCAGTTTATCCTTTCAGAAACTTCAATGAAAGTTCAGTACTTAGTCACTATTTCCCTTTCCTTCTCTGTCTCTCCATAGACTCCGTGTCCACGGGCTCCGTGTTTGGCCGCAGCACGACTCTGAACATGCAGACATCCCAGTTAAACACTCCTCAGGACACCTCCTGCACACATATTCTTGTGTTCCCCACTTCTGCTGGCCTCCAGGCCTTCAGCGGTAGGACACTTTCACTTTGGATTTTGTGTGTAAACTAAATTAAGTGCAGGACACTGAAGGCAAAATTTCTTTTTTTATGCACATGTCAATTTTGAGGTTTTGTGCTTTTCATAATGTGACTCATATAAATAAAACATTCAAGAAGTATTTCAAGTGTTTCTTTGACACACTTTATTTACAATTTGCTAATTTGTGTACATTTTAAGTACAAAAATCTAAACTTTCTGTAAAATCAA
Associated Phenotype:
Not determined