Busch Lab

ZMP

ftr01

Ensembl ID:
ENSDARG00000003909
ZFIN ID:
ZDB-GENE-070705-491
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A8E7R9]
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa32855 Nonsense Available for shipment Available now
sa19690 Nonsense Available for shipment Available now
sa39783 Nonsense Mutation detected in F1 DNA Not yet available
sa5717 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa32855
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100524 Nonsense 146 556 1 6
ENSDART00000132224 Nonsense 146 355 1 5
Genomic Location (Zv9):
Chromosome 2 (position 11462021)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 11887117
GRCz11 2 11670716
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGAGAATCTGTTTAAAGACAGGAGACACAATCTATTGGATCCCACTAGA[C/T]AACTCCATGAGATGATCTGCCCAAAACACGACAAACCACTGGAAATCTAC
Long Flanking Sequence:
TGAGATAACTTGTGTTGTCAAACACATATGAACCTATCTAATCGTGTGTGTACACACAAGGTAAGATGGCAGAAGCTAGTTTTTCTCAGGACCAGTTCAGCTGCTCAGTGTGTCTGGATATCTTAAAGGGTCCAGTGACCATTCCCTGTGGACACAGTTACTGTATGAGCTGTATTACAGACTGCTGGGATCAGGAGGATCAGAAGCAAGTCTATAGCTGCCCTCAGTGCAGAAACACCTTCACTTCAAGACCTGTGTTGTGTAAGAATGTCTTGATTGATGAGATGGTGAAGAAAGTAAAGAAGACTAACTTACAAACTGCTTGTCCTGCCCATGCTCATGCTGAACCTGGAGATGTGGAGTGTGACGTCTGTCCTGGAAGAAAATATAAAGCTGTCAAGTCATGTGTGGAGTGTCTGAACTCTTACTGCCGAAGCCATCTTGAACAACACGAGAATCTGTTTAAAGACAGGAGACACAATCTATTGGATCCCACTAGA[C/T]AACTCCATGAGATGATCTGCCCAAAACACGACAAACCACTGGAAATCTACTGTCGTACTGACCTGCAGTGCATTTGTTATCGATGTTTAATGGATGAACATAAAAACCATGAAGCTGTAACAGCTGAAGCTGAGAGGACAGAGAAACAGGTATGAACTGAATTTAGTTATTATTGTGCTTATAATTCTGACTTATACTGTACATGCTAACGCACAAATCTACATTGTTATCTTGGTGTCATTTAAAAAGGAATGTAGTAGTAAATAATAGTATCATTGTTTATTAATAAATAATGGTATTATTGTTTATTTGTTGTAATTGTATATCTTCCTGCTTTTCCTACAGAAGCTTTTGGGAAGAATCCAAACAAAGTTCAAGCAAGCAATCGAGGCAAGACAGAAGGAGCTGCAGGAGCTAAGAGATGCTGTGAAGTCTTATAAGGTGAATTTTCTAACGTTTGAGGATACTTTTAAACACATTGAAGCTGACTGAAGGTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19690
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100524 Nonsense 168 556 1 6
ENSDART00000132224 Nonsense 168 355 1 5
Genomic Location (Zv9):
Chromosome 2 (position 11462087)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 11887183
GRCz11 2 11670782
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGCCCAAAACACGACAAACCACTGGAAATCTACTGTCGTACTGACCTG[C/T]AGTGCATTTGTTATCGATGTTTAATGGATGAACATAAAAACCATGAAGCT
Long Flanking Sequence:
TGGCAGAAGCTAGTTTTTCTCAGGACCAGTTCAGCTGCTCAGTGTGTCTGGATATCTTAAAGGGTCCAGTGACCATTCCCTGTGGACACAGTTACTGTATGAGCTGTATTACAGACTGCTGGGATCAGGAGGATCAGAAGCAAGTCTATAGCTGCCCTCAGTGCAGAAACACCTTCACTTCAAGACCTGTGTTGTGTAAGAATGTCTTGATTGATGAGATGGTGAAGAAAGTAAAGAAGACTAACTTACAAACTGCTTGTCCTGCCCATGCTCATGCTGAACCTGGAGATGTGGAGTGTGACGTCTGTCCTGGAAGAAAATATAAAGCTGTCAAGTCATGTGTGGAGTGTCTGAACTCTTACTGCCGAAGCCATCTTGAACAACACGAGAATCTGTTTAAAGACAGGAGACACAATCTATTGGATCCCACTAGACAACTCCATGAGATGATCTGCCCAAAACACGACAAACCACTGGAAATCTACTGTCGTACTGACCTG[C/T]AGTGCATTTGTTATCGATGTTTAATGGATGAACATAAAAACCATGAAGCTGTAACAGCTGAAGCTGAGAGGACAGAGAAACAGGTATGAACTGAATTTAGTTATTATTGTGCTTATAATTCTGACTTATACTGTACATGCTAACGCACAAATCTACATTGTTATCTTGGTGTCATTTAAAAAGGAATGTAGTAGTAAATAATAGTATCATTGTTTATTAATAAATAATGGTATTATTGTTTATTTGTTGTAATTGTATATCTTCCTGCTTTTCCTACAGAAGCTTTTGGGAAGAATCCAAACAAAGTTCAAGCAAGCAATCGAGGCAAGACAGAAGGAGCTGCAGGAGCTAAGAGATGCTGTGAAGTCTTATAAGGTGAATTTTCTAACGTTTGAGGATACTTTTAAACACATTGAAGCTGACTGAAGGTTCAAAGTGATGTGATGATATGTGTCCTGATGCAAGTCCTAATTTTGCATAGTTTGACACATTCCTGTGTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25770
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100524 Essential Splice Site 195 556 1 6
ENSDART00000132224 Essential Splice Site 195 355 1 5
Genomic Location (Zv9):
Chromosome 2 (position 11462172)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 11887268
GRCz11 2 11670867
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAAAAACCATGAAGCTGTAACAGCTGAAGCTGAGAGGACAGAGAAACAGG[T/C]ATGAACTGAATTTAGTTATTATTGTGCTTATAATTCTGACTTATACTGTA
Long Flanking Sequence:
ACACAGTTACTGTATGAGCTGTATTACAGACTGCTGGGATCAGGAGGATCAGAAGCAAGTCTATAGCTGCCCTCAGTGCAGAAACACCTTCACTTCAAGACCTGTGTTGTGTAAGAATGTCTTGATTGATGAGATGGTGAAGAAAGTAAAGAAGACTAACTTACAAACTGCTTGTCCTGCCCATGCTCATGCTGAACCTGGAGATGTGGAGTGTGACGTCTGTCCTGGAAGAAAATATAAAGCTGTCAAGTCATGTGTGGAGTGTCTGAACTCTTACTGCCGAAGCCATCTTGAACAACACGAGAATCTGTTTAAAGACAGGAGACACAATCTATTGGATCCCACTAGACAACTCCATGAGATGATCTGCCCAAAACACGACAAACCACTGGAAATCTACTGTCGTACTGACCTGCAGTGCATTTGTTATCGATGTTTAATGGATGAACATAAAAACCATGAAGCTGTAACAGCTGAAGCTGAGAGGACAGAGAAACAGG[T/C]ATGAACTGAATTTAGTTATTATTGTGCTTATAATTCTGACTTATACTGTACATGCTAACGCACAAATCTACATTGTTATCTTGGTGTCATTTAAAAAGGAATGTAGTAGTAAATAATAGTATCATTGTTTATTAATAAATAATGGTATTATTGTTTATTTGTTGTAATTGTATATCTTCCTGCTTTTCCTACAGAAGCTTTTGGGAAGAATCCAAACAAAGTTCAAGCAAGCAATCGAGGCAAGACAGAAGGAGCTGCAGGAGCTAAGAGATGCTGTGAAGTCTTATAAGGTGAATTTTCTAACGTTTGAGGATACTTTTAAACACATTGAAGCTGACTGAAGGTTCAAAGTGATGTGATGATATGTGTCCTGATGCAAGTCCTAATTTTGCATAGTTTGACACATTCCTGTGTCCTATTTTATAATTCCTGGAACATCATTCGTGTTCAAAAATGTAATCCCTATCAAATTCCTACACCCAAACAGAACCCTGTCCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39783
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100524 Nonsense 271 556 3 6
ENSDART00000132224 None None 355 None 5
Genomic Location (Zv9):
Chromosome 2 (position 11464170)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 11889266
GRCz11 2 11672865
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGTGACACGACTGATCCAAGATCAGGAAAAGGCTGCAGTGAGTGAAGTT[G/T]AAAAACTCTCGGAGCAGCTGGAGGAGGAAATTGATGATCTTAGGAGGAGA
Long Flanking Sequence:
CTCCTTTTGTTACTGTATGTCTGTCGCATGGCTGTGTTTGTTTACCTTTCCTTGACAGAGCACATTCTAGTCAGCTGACCAATCAGTGAAGCCACCTGCAACCTATTATTGAGACCTACTTAAGGACTAAGTTTCCCACCTTTCAACATTCAGTTGTTCACGTCTCGGTCTGCTGTTCCCCATGACTGTTATCTTGCATTCCTTGCTACCAGAGTTGCTGTCAGCCTTTGTTCCTTGAAATTGGTACCAAGCAATTAAGCTAATAAGCTTTTTCTTGCAATTGGATGCCTTTACATTTCATCCTTGTGACCTGTCCGTAAGCGATTGCTGAAATGTTGTCCTGAGTAAAATCGTATTATGTGTGTCAACAGTGTTCTGCACAGACAGCAGTGGATGATAGTGAAAGGATCTTTACTGAACTCATCCACACCATTGAGAGAAGCCGATCTGAAGTGACACGACTGATCCAAGATCAGGAAAAGGCTGCAGTGAGTGAAGTT[G/T]AAAAACTCTCGGAGCAGCTGGAGGAGGAAATTGATGATCTTAGGAGGAGAGACTCTAAGCTGGAGCAGCTTTCACACATAGAAAATCATATTCATTTCCTCCAGGTAAACCCTAAAATACAAGACTTGGTAGGGCTGTGGTCAGGAATTCTGACAGACTTCATGTTTTATTTGCAGATGTTCCAGTATATATCTGAACACCCTAAATCTACAGACACATGTGGCATCACTGTCAGTTCCCTCATCCCTTTTCATGATGTGGTAAAGTCAATCTCTAAGCTGAAGGAAAAAGAGGGTTTCTGTAAAGAAGAGCTAGAAAAGTTCTCTGATAGAGGTAAAGTATATTCATTTACTTTTATTTTGTCTGATATTACATACAAGAATGTCTATTTCTTTTAAATGCTTATTTACATATTGATTAAAGTGTTTCTGCTACTTTTCCATAGTGACATGCAATGACATGACTCCCATCAGTGAATCAGTTCATACCCGGGAACAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5717
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100524 Nonsense 450 556 6 6
ENSDART00000132224 None None 355 None 5
ENSDART00000100524 Nonsense 450 556 6 6
ENSDART00000132224 None None 355 None 5
Genomic Location (Zv9):
Chromosome 2 (position 11468402)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 11893498
GRCz11 2 11677097
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACGCTGTTATTGGGAGGTTGAGTGGAGTGGAATTAAYGGTGTGTGTATAT[C/A]AGTGTCRTATAAGAGCATCAKCAGAAAGGCATTGTTTAATGAAGATATGT
Long Flanking Sequence:
CAGATCTCTGTGTGAAACTTCTTGTGCAGACAAAAATCTCACTGTACAATTACAATTAATAACAAAAATAATTCATATTTAAAACTTGTATGCTACATACAAATATAAACACAACCAACTTTTAAACCTTTTTTTTTTTTGGCGGTGGTGGGGTGAGTGACATTTGCAAAGTAATGTATAAATAGAAAAAACCATGTACACACACGCACACAGAAATATTAATTTATTCACACACTTAAACACGCACATAAGCATTCTAATAAGTAATTGTGTTTTATCTTCTCTAGGTTCCTGTCAGCTCACTCTTGATTCAAAGACAGTGAACCGTTACCTTCGTCTGTCTGAGGGAAACAAAGCAGTCAGTTTCACTGAAACACCCCAGCAGTATCGTGCTCATCCAGAAAGATTTGATGGGAGTTTTCAGGTGTTGTGTAGACAGAGTGTGTCGGAACGCTGTTATTGGGAGGTTGAGTGGAGTGGAATTAATGGTGTGTGTATAT[C/A]AGTGTCATATAAGAGCATCAGCAGAAAGGCATTGTTTAATGAAGATATGTTTGGATTCAATAGTCAGTCCTGGGGTTTGTACTGCTCTCCCTCCAATTACCTATTCATGCACAATAAGAGCAAGACTAAAATCCCTGTGTCCTCCACATCCTCTAGAGTAGGAGTGTATGTGGATCATAGGTCAGGAACTCTGCACTTCTACAGCGTCTCTGAGACTATGGCCCTCATCCATACAATCCAGACCACATTCACTCAGCCTCTATACCCTGGGTTTGGCTTAAATATCGGCTCAAATGTGAAACTGTGTCATCTAACAACATAGTAGAGAAATTTGGCATGTTACATGATGTAGCTTTGATTATTTTTATTGGGAATCTCTCACACAAGCAGTAACAATTGTGTATAATGTGTAAAAACACTAAGGACTGATGTACTGTAGCTTCTACTTACATAATCGTAGTCTGCTGTCGCAAACATGTCAATGTAAAGCTTTAACTAAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2084
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100524 Nonsense 450 556 6 6
ENSDART00000132224 None None 355 None 5
ENSDART00000100524 Nonsense 450 556 6 6
ENSDART00000132224 None None 355 None 5
Genomic Location (Zv9):
Chromosome 2 (position 11468402)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 11893498
GRCz11 2 11677097
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACGCTGTTATTGGGAGGTTGAGTGGAGTGGAATTAAYGGTGTGTGTATAT[C/A]AGTGTCRTATAAGAGCATCAKCAGAAAGGCATTGTTTAATGAAGATATGT
Long Flanking Sequence:
CAGATCTCTGTGTGAAACTTCTTGTGCAGACAAAAATCTCACTGTACAATTACAATTAATAACAAAAATAATTCATATTTAAAACTTGTATGCTACATACAAATATAAACACAACCAACTTTTAAACCTTTTTTTTTTTTGGCGGTGGTGGGGTGAGTGACATTTGCAAAGTAATGTATAAATAGAAAAAACCATGTACACACACGCACACAGAAATATTAATTTATTCACACACTTAAACACGCACATAAGCATTCTAATAAGTAATTGTGTTTTATCTTCTCTAGGTTCCTGTCAGCTCACTCTTGATTCAAAGACAGTGAACCGTTACCTTCGTCTGTCTGAGGGAAACAAAGCAGTCAGTTTCACTGAAACACCCCAGCAGTATCGTGCTCATCCAGAAAGATTTGATGGGAGTTTTCAGGTGTTGTGTAGACAGAGTGTGTCGGAACGCTGTTATTGGGAGGTTGAGTGGAGTGGAATTAATGGTGTGTGTATAT[C/A]AGTGTCATATAAGAGCATCAGCAGAAAGGCATTGTTTAATGAAGATATGTTTGGATTCAATAGTCAGTCCTGGGGTTTGTACTGCTCTCCCTCCAATTACCTATTCATGCACAATAAGAGCAAGACTAAAATCCCTGTGTCCTCCACATCCTCTAGAGTAGGAGTGTATGTGGATCATAGGTCAGGAACTCTGCACTTCTACAGCGTCTCTGAGACTATGGCCCTCATCCATACAATCCAGACCACATTCACTCAGCCTCTATACCCTGGGTTTGGCTTAAATATCGGCTCAAATGTGAAACTGTGTCATCTAACAACATAGTAGAGAAATTTGGCATGTTACATGATGTAGCTTTGATTATTTTTATTGGGAATCTCTCACACAAGCAGTAACAATTGTGTATAATGTGTAAAAACACTAAGGACTGATGTACTGTAGCTTCTACTTACATAATCGTAGTCTGCTGTCGCAAACATGTCAATGTAAAGCTTTAACTAAC
Associated Phenotype:
Not determined