Busch Lab

ZMP

tm9sf2

Ensembl ID:
ENSDARG00000003866
ZFIN ID:
ZDB-GENE-030131-6302
Description:
transmembrane 9 superfamily member 2 [Source:RefSeq peptide;Acc:NP_997893]
Human Orthologue:
TM9SF2
Human Description:
transmembrane 9 superfamily member 2 [Source:HGNC Symbol;Acc:11865]
Mouse Orthologue:
Tm9sf2
Mouse Description:
transmembrane 9 superfamily member 2 Gene [Source:MGI Symbol;Acc:MGI:1915309]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa19513 Essential Splice Site Available for shipment Available now
sa18297 Nonsense Available for shipment Available now
sa32695 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa19513
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019743 Essential Splice Site 52 658 1 17

The following transcripts of ENSDARG00000003866 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 28743676)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 28994505
GRCz11 1 29798436
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGTAAGAAAGAAGCGGGCGACAAAAACAGCGAAGTCCCAGACTGCAAGG[T/A]AAATATTCACATTTAGAAGTGTACTAAATTAGTTTGCTTAAACGTATGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18297
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019743 Nonsense 73 658 2 17

The following transcripts of ENSDARG00000003866 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 28746406)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 28997235
GRCz11 1 29801166
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCTTTGTGAACAGGCTGGATTCTGTGGAGTCAGTTTTACCCTATGAATA[T/A]ACTGCGTGAGTTTAACATGTTTGTCATTTTTTTGTTCATKCAACATTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32695
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019743 Nonsense 327 658 9 17

The following transcripts of ENSDARG00000003866 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 28754532)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 29005361
GRCz11 1 29809292
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGAATGGTCGCTATGATCATGCTTCGAACACTTCATAAAGATATCGCT[C/T]GATACAACCAGATGGACTCTGTGGTGAGTTCCACTCTACAAGATTACATC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25597
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019743 Nonsense 423 658 12 17

The following transcripts of ENSDARG00000003866 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 28762334)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 29013163
GRCz11 1 29817094
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGAGGTCAACTTGTCTTTCTTTCTCTCTCTCTTCCCAGCTTTCGGTGGT[G/T]AGAAGTGGAAGACCAATGTTCTGTTGACAGCTTTTCTCTGTCCAGGGTGG
Associated Phenotype:
Not determined