Busch Lab

ZMP

snapc1b

Ensembl ID:
ENSDARG00000003827
ZFIN ID:
ZDB-GENE-040426-716
Description:
snRNA-activating protein complex subunit 1 [Source:RefSeq peptide;Acc:NP_956548]
Human Orthologue:
SNAPC1
Human Description:
small nuclear RNA activating complex, polypeptide 1, 43kDa [Source:HGNC Symbol;Acc:11134]
Mouse Orthologue:
Snapc1
Mouse Description:
small nuclear RNA activating complex, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:1922877]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa15527 Essential Splice Site Available for shipment Available now
sa14120 Nonsense Available for shipment Available now
sa8508 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa24943 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa15527
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003888 Essential Splice Site 44 350 2 10

The following transcripts of ENSDARG00000003827 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 37996162)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37472974
GRCz11 13 37598864
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
NNNGTTGGTATTTTTWTTTTTCAATGTTTATTTCTATTTTTTTCCCTGCA[G/A]TGGTAAACAAGAGCCAAGAGAGAAAAGGAYTTTTGCTCGTCTGGTTCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14120
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003888 Nonsense 125 350 3 10

The following transcripts of ENSDARG00000003827 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 37993942)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37470754
GRCz11 13 37596644
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGCAGTTTGAGAGGGAWGCRATGAACTCWCAACATTATGATGTTACATA[T/A]ATCTTCAGAAAGCTCCTGTCAGAAAAAGCTTTCCACTTTACGGCCATGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8508
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003888 Essential Splice Site 180 350 4 10

The following transcripts of ENSDARG00000003827 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 37991754)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37468566
GRCz11 13 37594456
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGATCCACCGTCACGTCCACARCAGCTTGTTAACACTGACCTGCTAGARG[T/G]GAGTCATGGCAGCAACRTTRAAATGAATAAAAAATGCATTGCTACAGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24943
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003888 Essential Splice Site 245 350 6 10

The following transcripts of ENSDARG00000003827 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 37988523)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37465335
GRCz11 13 37591225
KASP Assay ID:
554-7295.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTAGCAATTTGAAGAGCAGGATCCTGGAGAAGGACCTTCGAATCAAGAAG[T/A]AAGAGACTGAGATTAAAAATGTTCTTCATTTTTCTCTCTTTTTAATTATA
Associated Phenotype:
Not determined