Busch Lab

ZMP

tada2b

Ensembl ID:
ENSDARG00000003769
ZFIN ID:
ZDB-GENE-050522-557
Description:
Transcriptional adapter 2-beta [Source:UniProtKB/Swiss-Prot;Acc:Q503N9]
Human Orthologue:
TADA2B
Human Description:
transcriptional adaptor 2B [Source:HGNC Symbol;Acc:30781]
Mouse Orthologue:
Tada2b
Mouse Description:
transcriptional adaptor 2B Gene [Source:MGI Symbol;Acc:MGI:3035274]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa34134 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa40969 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa34134
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004365 Essential Splice Site 90 486 1 2
Genomic Location (Zv9):
Chromosome 7 (position 41131567)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 39467824
GRCz11 7 39738841
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGAGCAGTCGCTGCTCGATGCCATCGAGCAATATGGATTTGGAAATTGG[G/A]TACGACTCTCAAAATAATTACACATGGATGCAGCTCATAAAAAGCTGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40969
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004365 Nonsense 422 486 2 2
Genomic Location (Zv9):
Chromosome 7 (position 41134005)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 39470262
GRCz11 7 39741279
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCAGCTATTGAGAACCTGTCCGGATTTGAGCTGCTATCCGATAGGGAG[A/T]AAGTACTGTGCAACTCCATGAACCTCAGTCCCATGCGTTATCTGACAGTC
Associated Phenotype:
Not determined