Busch Lab

ZMP

si:dkey-183n20.16

Ensembl ID:
ENSDARG00000003750
ZFIN ID:
ZDB-GENE-030131-4420
Description:
phosphoribosylformylglycinamidine synthase [Source:RefSeq peptide;Acc:NP_001038667]
Human Orthologue:
PFAS
Human Description:
phosphoribosylformylglycinamidine synthase [Source:HGNC Symbol;Acc:8863]
Mouse Orthologue:
Pfas
Mouse Description:
phosphoribosylformylglycinamidine synthase (FGAR amidotransferase) Gene [Source:MGI Symbol;Acc:MGI:2

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa23705 Essential Splice Site Available for shipment Available now
sa37025 Nonsense Mutation detected in F1 DNA Not yet available
sa37026 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa23705
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012581 Essential Splice Site 121 1314 4 29
Genomic Location (Zv9):
Chromosome 20 (position 25478078)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25549381
GRCz11 20 25448471
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCTGAGTCAGGTGACGAGAGTCGAGCTCTCCCGCAGACATCTCATCAAG[G/A]TTAGGAGAGCAGCTTTAAATAGACTTACATTACAGTTTTTTCCCTTGTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29360
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012581 Nonsense 259 1314 7 29
Genomic Location (Zv9):
Chromosome 20 (position 25480432)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25551735
GRCz11 20 25450825
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAAGGAGACGCTCTTCAGCCTCATTATGGGCACTCAGCAGCACAGCAAC[C/T]AGAATAATGTCATCAAATTCTGTGACAACAGCAGGTTAGACACTTCACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37025
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012581 Nonsense 580 1314 15 29
Genomic Location (Zv9):
Chromosome 20 (position 25489255)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25560558
GRCz11 20 25459648
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCCCCTCTGACCGGAGCTTCCTAGAGAGGGTCTGTCAGAGGGAAAAGTG[T/A]CCTGTCGACTTTGTGGGCAAGATAACTGGTGATGGCAAGGTGAGTCGCAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29361
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012581 Splice Site, Nonsense 891 1314 22 29
Genomic Location (Zv9):
Chromosome 20 (position 25496138)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25567441
GRCz11 20 25466531
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTTTTTTTATCTCTCTGCAATCTGTTGATTTTAACTTTATATTGCAGAT[C/T]GACTGCTGACTGCTGGACATGATGTCAGTGATGGGGGACTTATTTCTTGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29362
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012581 Nonsense 1224 1314 29 29
Genomic Location (Zv9):
Chromosome 20 (position 25501461)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25572764
GRCz11 20 25471854
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGTTGTTTGTTCTGCAGGTCTGATGCAGTTTCGTTCTCCTGAGGCTCAA[C/T]AGAAGCTAATTGGCTCCTCTCTGGCTCCTCTGCGTTATGTGGATGACTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37026
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012581 Nonsense 1300 1314 29 29
Genomic Location (Zv9):
Chromosome 20 (position 25501691)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25572994
GRCz11 20 25472084
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGGCTTGGGCTCCTCAGCACCTCAGGGGCTCATTGGAGCCATCACCGTG[G/A]CTTAGCATGTTCCGAAACGCAGCAGCCTGGTGCCAGAATTCATAGAGATT
Associated Phenotype:
Not determined