Busch Lab

ZMP

atp7a

Ensembl ID:
ENSDARG00000003699
ZFIN ID:
ZDB-GENE-060825-45
Description:
copper-transporting ATPase 1 [Source:RefSeq peptide;Acc:NP_001036185]
Human Orthologue:
ATP7A
Human Description:
ATPase, Cu++ transporting, alpha polypeptide [Source:HGNC Symbol;Acc:869]
Mouse Orthologue:
Atp7a
Mouse Description:
ATPase, Cu++ transporting, alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:99400]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa35686 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa42389 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa17337 Nonsense Available for shipment Available now
sa35687 Nonsense Mutation detected in F1 DNA Not yet available
sa38992 Nonsense Mutation detected in F1 DNA Not yet available
sa22467 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35686
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054977 Essential Splice Site None 1500 1 23
ENSDART00000124072 None None 1483 None 22
ENSDART00000128097 Essential Splice Site None 208 1 3
Genomic Location (Zv9):
Chromosome 14 (position 23400657)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 22100447
GRCz11 14 22397692
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGATTAAACTTGTTGGTCCTGTGACTCAGCATCAGCTCTTCGCACGAAAG[G/A]TAAAACAATCCAGCAGTTTTGTTGTTCTTCGTGTCTGTGGTTTAAGTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42389
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054977 Essential Splice Site 40 1500 2 23
ENSDART00000124072 Essential Splice Site 41 1483 1 22
ENSDART00000128097 Essential Splice Site 40 208 2 3
Genomic Location (Zv9):
Chromosome 14 (position 23403581)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 22103371
GRCz11 14 22400616
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTCCATTGAAGGCCGGATCGGAGGCCTGCCAGGAGTCATTCATATACAG[G/A]TTAGAGATATGGATGTCAGTTACACCAAGTGAACTCTTAAGAATAAACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17337
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054977 Nonsense 680 1500 9 23
ENSDART00000124072 Nonsense 681 1483 8 22
ENSDART00000128097 None None 208 None 3
Genomic Location (Zv9):
Chromosome 14 (position 23423574)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 22123364
GRCz11 14 22420609
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACAAGYATCATCAANNNCATAACGCCACCGCTGAGGACAGAGCGAAATA[T/G]CACTCCACAATGTTYCTGGAGAAACAGCTTCTGCCAGGCCTCTCCATCAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28303
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054977 Essential Splice Site 912 1500 13 23
ENSDART00000124072 Essential Splice Site 913 1483 12 22
ENSDART00000128097 None None 208 None 3
Genomic Location (Zv9):
Chromosome 14 (position 23429893)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 22129683
GRCz11 14 22426928
KASP Assay ID:
2260-7501.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACCCTCTCTCAGATCGTCAAACTGGTGGAGGAGGCACAGACTTCAAAGG[T/C]GCGTCTGAGAGCTCAGCATCTGCTAGCATTTCAGCTCTTTAGATAATAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35687
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054977 Nonsense 917 1500 14 23
ENSDART00000124072 Nonsense 918 1483 13 22
ENSDART00000128097 None None 208 None 3
Genomic Location (Zv9):
Chromosome 14 (position 23430974)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 22130764
GRCz11 14 22428009
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTGGTCTAAATAAACTTTTTTCATTTAACGATTTCAGGCTCCCATCCAG[C/T]AGTTTGCAGATAAAATCAGTAGCTACTTTGTCCCGTTCATCGTTGTGATC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28304
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054977 Nonsense 1036 1500 16 23
ENSDART00000124072 Nonsense 1037 1483 15 22
ENSDART00000128097 None None 208 None 3
Genomic Location (Zv9):
Chromosome 14 (position 23433337)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 22133127
GRCz11 14 22430372
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTTTCAGATTCAGTCTGTGGTATTTGACAAAACAGGCACAATCACATA[T/A]GGAGCTCCCAAAGTGGTCCAGGTGAAGATGCTGGCAGAAGGGAATCGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38992
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054977 Nonsense 1088 1500 17 23
ENSDART00000124072 Nonsense 1089 1483 16 22
ENSDART00000128097 None None 208 None 3
Genomic Location (Zv9):
Chromosome 14 (position 23434638)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 22134428
GRCz11 14 22431673
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTGGCATTTGGATTCACAAAGCGTCTTCTGTGTTTAGGAGTTGGGGACA[G/T]AGTCTCTTGGCACTTGCACAGATTTTCAAGCTGTGCCAGGTTGTGGGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22467
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054977 Nonsense 1498 1500 23 23
ENSDART00000124072 Nonsense 1481 1483 22 22
ENSDART00000128097 None None 208 None 3
Genomic Location (Zv9):
Chromosome 14 (position 23442121)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 22141911
GRCz11 14 22439156
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCGAACCCGACAAACACTCTCTACTGGTGGGAGACGATCACTGCGACAAC[G/T]AGATAGTCTGAGGGTCTCTGGAGCTTCGCTTTACCGCAGTGCCTGCAGTC
Associated Phenotype:
Not determined