Busch Lab

ZMP

slc5a8l

Ensembl ID:
ENSDARG00000003697
ZFIN ID:
ZDB-GENE-061110-98
Description:
Sodium-coupled monocarboxylate transporter 1 [Source:UniProtKB/Swiss-Prot;Acc:Q3ZMH1]
Human Orthologue:
SLC5A8
Human Description:
solute carrier family 5 (iodide transporter), member 8 [Source:HGNC Symbol;Acc:19119]
Mouse Orthologue:
Slc5a8
Mouse Description:
solute carrier family 5 (iodide transporter), member 8 Gene [Source:MGI Symbol;Acc:MGI:2384916]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa31539 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31539
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032982 Essential Splice Site 158 610 4 15
ENSDART00000135185 Essential Splice Site 89 159 4 5
Genomic Location (Zv9):
Chromosome 6 (position 49013217)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 49073964
GRCz11 6 49072617
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTAAAAGTAAAAATCTTACTAAGATTTGTGGAAAACATCTTGTGTTGC[A/G]GTTACTGGTCTGGATCTGTGGGGAGTGTTAGTGGCAACGGGGGCTGTCTG
Associated Phenotype:
Not determined