Busch Lab

ZMP

LOC100330423

Ensembl ID:
ENSDARG00000003682
Human Orthologue:
C12orf51
Human Description:
chromosome 12 open reading frame 51 [Source:HGNC Symbol;Acc:26611]
Mouse Orthologue:
Gm15800
Mouse Description:
predicted gene 15800 Gene [Source:MGI Symbol;Acc:MGI:3647820]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa41090 Nonsense Mutation detected in F1 DNA Not yet available
sa30896 Nonsense Mutation detected in F1 DNA Not yet available
sa21158 Nonsense Available for shipment Available now
sa11121 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41090
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086005 Nonsense 578 1619 8 23
ENSDART00000086005 Nonsense 578 1619 8 23
Genomic Location (Zv9):
Chromosome 7 (position 75690788)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 72193694
GRCz11 7 72546060
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCATCAGAATGCGACAATGCTCTATTAAACATGAAGCCTGAAGACATGT[T/A]GTGGTTTCACCGGGGGTTGACCTTGCTTTTGATTTTACGGCATCTTACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30896
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086005 Nonsense 578 1619 8 23
ENSDART00000086005 Nonsense 578 1619 8 23
Genomic Location (Zv9):
Chromosome 7 (position 75690788)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 72193694
GRCz11 7 72546060
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCATCAGAATGCGACAATGCTCTATTAAACATGAAGCCTGAAGACATGT[T/A]GTGGTTTCACCGGGGGTTGACCTTGCTTTTGATTTTACGGCATCTTACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21158
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086005 Nonsense 588 1619 8 23
Genomic Location (Zv9):
Chromosome 7 (position 75690818)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 72193664
GRCz11 7 72546090
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATGAAGCCTGAAGACATGTTGTGGTTTCACCGGGGGTTGACCTTGCTTT[T/A]GATTTTACGGCATCTTACTAATAAGGACCCGCAAGGTCTTGGCGTCACCG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27113
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086005 Nonsense 996 1619 12 23
Genomic Location (Zv9):
Chromosome 7 (position 75696808)
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTAGATCATGTGGTACATGTCGTTTCTGCAGAACTGTACTGAGTGAGAAA[A/T]AAACCGTCCTCAAGCCAAAATCTCCAGAGAAGACCAAACCCGATGAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11121
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086005 Nonsense 1442 1619 21 23
Genomic Location (Zv9):
Chromosome 7 (position 75713830)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 72170662
GRCz11 7 72569092
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
NNNNTGTGTGTGTGTCTGTGTGTGTTAAGCTGGGAGAATAAGGATGTGTA[T/A]GTGCGAGCGGTGCGTGAGCTGCGTCTGCGGGAGCTGCAGAATGTGGAGTG
Associated Phenotype:
Not determined