Busch Lab

ZMP

cryl1

Ensembl ID:
ENSDARG00000003675
ZFIN ID:
ZDB-GENE-060810-7
Description:
lambda-crystallin homolog [Source:RefSeq peptide;Acc:NP_001038806]
Human Orthologue:
CRYL1
Human Description:
crystallin, lambda 1 [Source:HGNC Symbol;Acc:18246]
Mouse Orthologue:
Cryl1
Mouse Description:
crystallin, lambda 1 Gene [Source:MGI Symbol;Acc:MGI:1915881]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa34613 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27382
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062656 Nonsense 254 315 7 8
ENSDART00000130023 None None 268 None 7
Genomic Location (Zv9):
Chromosome 9 (position 22432449)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21588235
GRCz11 9 21399104
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTTTAATTTTAACTGTGTTCTGTCTGTACAGGTATGAAAGATTATCTT[C/T]AGCGCTACAGTGAGGGCATGAAGAGGGTTCTTAATACTTTTGGGCCTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34613
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062656 Nonsense 275 315 7 8
ENSDART00000130023 None None 268 None 7
Genomic Location (Zv9):
Chromosome 9 (position 22432512)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21588298
GRCz11 9 21399167
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGGCATGAAGAGGGTTCTTAATACTTTTGGGCCTGTTCCAGATTTTTCT[G/T]GAGAGCCCGCAGCTAGAGTTATAAAAGTATGTTACAATAGTTTATTTTAG
Associated Phenotype:
Not determined