Busch Lab

ZMP

zgc:101757

Ensembl ID:
ENSDARG00000003635
ZFIN ID:
ZDB-GENE-041212-51
Description:
diacylglycerol O-acyltransferase 2 [Source:RefSeq peptide;Acc:NP_001008626]
Human Orthologue:
MOGAT3
Human Description:
monoacylglycerol O-acyltransferase 3 [Source:HGNC Symbol;Acc:23249]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa5744 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa5744
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015136 Nonsense 218 336 6 8
ENSDART00000015136 Nonsense 218 336 6 8
Genomic Location (Zv9):
Chromosome 5 (position 40201378)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 38000768
GRCz11 5 38600921
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTCTACAGGAGTAAACACTGTGGTCATAAAACACAGGAAAGGCTTTGTA[C/T]GACTGGCTCTTGAACACGGGTGAGAAAGAGACRAGAAKAAGATAAAAAGA
Long Flanking Sequence:
AATGTAGGAACTTTCCTGTTGTAGCATGGCTGCAGCAGGCACACTGAAATTATGTAGCATCTGAAAATAGTACCCAGCTAGGTAACTAGTTACCTAGTATAGTTCTAGCCACATTAGTCCAGAAAATAAAAACTTTTAAGTTTCTGTCAGACTTTTTTATTTTTGAACAAGATGTTAATGGTCTAATCCAATTTAATGATTTATGCTAAACTAAGCTGAAAGTTCTCCCATCAGACCCAGAGATCAACTGAATGGATTTTAACTCTTGCGGAGGTTTAAGCCTATTTCCCCAAAAAAGAGGACTGTTATTTTAAGAAGTTTGTCTTCATTTACTCTTTTTTAAAGGATTGCTGCCTGTCAGTAAGGCAAGTTTGGATTATTTGCTGAGCCAAACTGGTGTGGGTAACGCTGTGGTCATCATCATTGGTGGAGCAGAGGAATCACTGACCTCCTCTACAGGAGTAAACACTGTGGTCATAAAACACAGGAAAGGCTTTGTA[C/T]GACTGGCTCTTGAACACGGGTGAGAAAGAGACAAGAATAAGATAAAAAGACAGAGTATCAGCTGACTGAAATAAAACCTTGTTTTAAAGTAGATACTGGGACATACCAGGGGGCATAAGCAAACTTTCAAAGGGGTCACAGGAGGATTTGAAAATAATATTAATTATATAAAAACCTATTTATTTTATTGATCATACTATCAATATTCACACTATTCATTTTAAATTTTAAACTTTAAGACATTAAGAAAACAATGCAGGGATTTACATCAATTCTAGCTTAAAAAGTTATACTTTTAAGTATTAATCCTTAAATTAATGTTAATTATAATTAATTATCAGTAACATTAATATAAAAAATGTAAACAATTACACTTTAAATATTGAAAATGAATGATCACATTTCAAACAAATGTATCACATTTTCCCCTTCATGAACTGTTTGTTTCCCAGATTGGGTTTAAAAAATATTAAAAAGAAAAAGCTGTCAAAATTCTTGAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2259
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015136 Nonsense 218 336 6 8
ENSDART00000015136 Nonsense 218 336 6 8
Genomic Location (Zv9):
Chromosome 5 (position 40201378)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 38000768
GRCz11 5 38600921
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTCTACAGGAGTAAACACTGTGGTCATAAAACACAGGAAAGGCTTTGTA[C/T]GACTGGCTCTTGAACACGGGTGAGAAAGAGACRAGAAKAAGATAAAAAGA
Long Flanking Sequence:
AATGTAGGAACTTTCCTGTTGTAGCATGGCTGCAGCAGGCACACTGAAATTATGTAGCATCTGAAAATAGTACCCAGCTAGGTAACTAGTTACCTAGTATAGTTCTAGCCACATTAGTCCAGAAAATAAAAACTTTTAAGTTTCTGTCAGACTTTTTTATTTTTGAACAAGATGTTAATGGTCTAATCCAATTTAATGATTTATGCTAAACTAAGCTGAAAGTTCTCCCATCAGACCCAGAGATCAACTGAATGGATTTTAACTCTTGCGGAGGTTTAAGCCTATTTCCCCAAAAAAGAGGACTGTTATTTTAAGAAGTTTGTCTTCATTTACTCTTTTTTAAAGGATTGCTGCCTGTCAGTAAGGCAAGTTTGGATTATTTGCTGAGCCAAACTGGTGTGGGTAACGCTGTGGTCATCATCATTGGTGGAGCAGAGGAATCACTGACCTCCTCTACAGGAGTAAACACTGTGGTCATAAAACACAGGAAAGGCTTTGTA[C/T]GACTGGCTCTTGAACACGGGTGAGAAAGAGACAAGAATAAGATAAAAAGACAGAGTATCAGCTGACTGAAATAAAACCTTGTTTTAAAGTAGATACTGGGACATACCAGGGGGCATAAGCAAACTTTCAAAGGGGTCACAGGAGGATTTGAAAATAATATTAATTATATAAAAACCTATTTATTTTATTGATCATACTATCAATATTCACACTATTCATTTTAAATTTTAAACTTTAAGACATTAAGAAAACAATGCAGGGATTTACATCAATTCTAGCTTAAAAAGTTATACTTTTAAGTATTAATCCTTAAATTAATGTTAATTATAATTAATTATCAGTAACATTAATATAAAAAATGTAAACAATTACACTTTAAATATTGAAAATGAATGATCACATTTCAAACAAATGTATCACATTTTCCCCTTCATGAACTGTTTGTTTCCCAGATTGGGTTTAAAAAATATTAAAAAGAAAAAGCTGTCAAAATTCTTGAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26534
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015136 Nonsense 306 336 8 8
Genomic Location (Zv9):
Chromosome 5 (position 40204834)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 38004224
GRCz11 5 38604377
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAAACGTCCCTCTGGTGAAAATTCCAACTCAGGAACAGGTGGATCATTA[C/A]CACGGTTTATACATGGCATCTCTGGCTGATCTTTTCCACAAGCATAAGAC
Long Flanking Sequence:
AGCTTTTTGTCACAAATGCCTGTGTGATCACTTATCCGTCAATGTAGAAAAGTGGTCAAATTATGATTTTCGTTATTAAAAAAAAAATTGCATACTAACCTTAAGGAAAACTCCCAATCATAGATATATGTATACATGTGTATCTCTGGCTTTGGATGGCCACAGTCCTCCACTGCAGCTTGGTCCCACATTCATTTCAAAGGAGCGCTACCCTGTAGTAAAATGGCGGCTCTATTGACGCATTCCTTCCACGAGACAACAACAGGGCAAGCGACATCTAACGTATATACTTATGGTGTTTGCATAAACTGTGTTTTGAATGCTTTGAAACAGTGCATCATTTTGCTTAGCAATTGATTAAACCTTTTCAAAGTTTTGAAAAGCTGGATTAAAGTTGCCCTTCTTTGATATGATTGCAATGTACCTTTGTGTCTTCCAGTGGGCTGCCCCATAAACGTCCCTCTGGTGAAAATTCCAACTCAGGAACAGGTGGATCATTA[C/A]CACGGTTTATACATGGCATCTCTGGCTGATCTTTTCCACAAGCATAAGACCAGCTATGGACTGGCAGAGACGCACGAGCTGCACTTCATTTAGCAGTGCTGGAAAGCACAAAGCCATTTAAAAAGCTGACTGGGATATAATGTGGGGCTGATATAGGAAAAGGACAATGCACTTATTTCTGTACTGTTCCATGTGAATGTTTTAACTTCTTGGTTCTCTGAAATGATTCACAAAGCACAAAATGAACCAAATGAATACGGAGATGGGCATTTGTCTGTAACAAAACACTCATCCTTAAGAAAGGCAAAAGGTTTGCTTACGGTTATCTCAGCTTTGTTCTGTAAATTTGCACTGAAATTTTTACAACATGTTAGTGTTTATTATAAAGGTTATACAAAGACTTTTGAAGAAAATCATTTTTAAAAATTGGTTTAATATAAATGATTTACATATGTATTTTGTTATGTCTATTCATGTGAAAGATTATAAAACCAGCACAT
Associated Phenotype:
Not determined