Busch Lab

ZMP

si:dkey-31f5.1

Ensembl ID:
ENSDARG00000003615
ZFIN ID:
ZDB-GENE-041210-179
Description:
solute carrier family 26, member 3 [Source:RefSeq peptide;Acc:NP_001035265]
Human Orthologue:
SLC26A3
Human Description:
solute carrier family 26, member 3 [Source:HGNC Symbol;Acc:3018]
Mouse Orthologue:
Slc26a3
Mouse Description:
solute carrier family 26, member 3 Gene [Source:MGI Symbol;Acc:MGI:107181]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa9689 Nonsense Available for shipment Available now
sa40277 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa9689
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101043 Nonsense 13 762 2 21
ENSDART00000138662 Nonsense 13 694 1 17
Genomic Location (Zv9):
Chromosome 4 (position 17874471)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18817311
GRCz11 4 18806287
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTGCTTTTACACAATGCTGCGAGCGTCAGCGCAGAAGTACACGGTGAGC[A/T]GAGCACTTTACTCAGAAGAGCACCTAGAAGAGGAACATGCTAAAGCCTAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26282
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101043 Splice Site, Nonsense 236 762 6 21
ENSDART00000138662 Nonsense 236 694 5 17
Genomic Location (Zv9):
Chromosome 4 (position 17881130)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18823970
GRCz11 4 18812946
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATATTAGGGCTGACGGTCCCAGGTTTTAGCGGACCACTATCTATCATATA[T/A]GTAGGTCATTTCACACTTTTTCATACAAATTGCAATTATGATTGTCAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40277
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101043 Nonsense 380 762 10 21
ENSDART00000138662 Nonsense 379 694 9 17
Genomic Location (Zv9):
Chromosome 4 (position 17884460)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18827300
GRCz11 4 18816276
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCAGGAACTCATTGCCTTTGGAGCCAGCAACATCTTTGGAGGATCGTTC[A/T]AGGCTCTGGCAGCAAGTACGGCTCTGTCCAGAAGCGCAGTTCAGGAAAGC
Associated Phenotype:
Not determined