Busch Lab

ZMP

rpl3

Ensembl ID:
ENSDARG00000003599
ZFIN ID:
ZDB-GENE-030131-1291
Description:
60S ribosomal protein L3 [Source:RefSeq peptide;Acc:NP_001001590]
Human Orthologues:
AC096766.1, RPL3
Human Description:
ribosomal protein L3 [Source:HGNC Symbol;Acc:10332]
Mouse Orthologues:
Gm5879, Rpl3
Mouse Descriptions:
predicted gene 5879 Gene [Source:MGI Symbol;Acc:MGI:3647624]
ribosomal protein L3 Gene [Source:MGI Symbol;Acc:MGI:1351605]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa20025 Essential Splice Site Available for shipment Available now
sa16344 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26076
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011251 Nonsense 122 403 4 9
ENSDART00000138327 None None 188 None 4

The following transcripts of ENSDARG00000003599 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 30020318)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 29738357
GRCz11 3 29869199
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTGCGTGCCAACCTCTTGTTCTCCCCTGCCCTCATCTACCACCTTCAG[G/A]TATAAGTCCAAGAAGAAGGCCTTTACCAAGTACTGCAAGAGGTGGCAAGA
Long Flanking Sequence:
GGTGGAGGCAGTGACCGTTGTGGAGACTCCTCCCATGATTGTGGTGGGTGTTGTTGGATACGTCATGACCCCTCGTGGTCTGCGCTCATTCAAGACCATCTTTGCTGAGCACATCAGTGATGAGTGCAAGCGTCGCTTCTACAAGAACTGGTAAGTTAAACAACTTCTGGTCGCAGTGCATGCATATTTAGTCTGGAGCTGGTGGTAGCTGGCCAGATTAAACAATGTTGTTTTTTTCTGAGCCAGTCTAATTTGTCGGTATGGTGCAGCTCCGCTCAGGTGCCTCGTGCCCTGATGAGCTCCGGGCTCCGCTGGCCGGTGGAAAGGGCTCCTTAGAAACCGTGCCATGAGCCAAAATGACCTAGTGCTGTCGATGCCTCCCCTTTTTTTATGAGGATGGGCAAGCAGCCGTGCCCAGTCTCCTTCCACTGGCCCACTGGGCTATGAAGGAACTGCGTGCCAACCTCTTGTTCTCCCCTGCCCTCATCTACCACCTTCAG[G/A]TATAAGTCCAAGAAGAAGGCCTTTACCAAGTACTGCAAGAGGTGGCAAGATGAAGAGGGCAAGAAGCAGCTGGAGAAAGACTTTTCCTCCATGAAGAAGTACTGCCAGATCATTCGCATCATTGCCCACACTCAGGTGAGCTTAAACTGCTCATTTTAACTCCGTAATTGTTTAAAATGATTTAATTTTTAAATTTAATCCATTGCATGATTTTCCTTTTTTCCTCAGATGCGCCTGCTGCCCCACAGACAGAAGAAGTCTCACTTGATGGAGATCCAGCTGAACGGAGGCACCATCTCCGATAAGGTTGACTGGGCCAGAGAGAAGCTTGAGCAGTCCATTCCCATCGCTAATGTCTTCTCTCAGGATGAGATGATTGACGTTATTGGTGTTACCAAGGGACATGGATGCAAGGGTAGGTGGACTGCTTTCTCTTTTCCCGCTTTTGAAGTGTTTACTTTAGCGTCGTGCATGTAATGATGAAAAACATGGATTAACCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20025
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011251 Essential Splice Site 283 403 6 9
ENSDART00000138327 Essential Splice Site 135 188 3 4

The following transcripts of ENSDARG00000003599 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 30019526)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 29737565
GRCz11 3 29868407
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGTGCTGGACAGAAGGGCTACCACCACCGCACAGAAATCAACAAAAAGG[T/A]AATGCTTCAGAAAGTCACTCAAATGTTCATGGCATACGTTTGTGGACGTT
Long Flanking Sequence:
ACCATCTCCGATAAGGTTGACTGGGCCAGAGAGAAGCTTGAGCAGTCCATTCCCATCGCTAATGTCTTCTCTCAGGATGAGATGATTGACGTTATTGGTGTTACCAAGGGACATGGATGCAAGGGTAGGTGGACTGCTTTCTCTTTTCCCGCTTTTGAAGTGTTTACTTTAGCGTCGTGCATGTAATGATGAAAAACATGGATTAACCGCGTCAGGCATGGCGCCCGAAACGCATGAGGAAATTTCCCATGCTGCCTTCCTTCTGACAGCACACTTGCCCTTTTTTAGAAGCAAATGCAAACTTGAATACTTTTCTGATCAAAGATGTGTTTCTGTAGGTGTGACTAGCCGTTGGCACACAAAGAAGCTGCCCCGCAAGACCCATCGTGGTCTGCGTAAGGTGGCTTGTATTGGAGCCTGGCATCCTGCCCGTGTGGCTTTCTCTGTGGCTCGTGCTGGACAGAAGGGCTACCACCACCGCACAGAAATCAACAAAAAGG[T/A]AATGCTTCAGAAAGTCACTCAAATGTTCATGGCATACGTTTGTGGACGTTTTGTTGCAGTCTTGCCTCATGCATGCTTTTGTTCACCTTTAGATCTACAAGATTGGTGTGGGCTATCATAACAAGGACGGAAAACTTGTCAAGAACAACGCCTCTACTGATTATGATCTGTCCAACAAGAGCATCAACCCTCTGGTGAGTGTGCTGTTGTCTCCCTATTGTGAATTTGATAAATTGTTTATATGCATGCATTAATACTGATGCCTTTTTATTTTAGGGTGGCTTTGTGCATTATGGTGAGGTGACGAATGACTTCCTCATGCTGAAAGGCTGTGTGGTCGGAACCAAGAAGAGGGTTTTGACTCTGCGCAAATCTCTACTGGTCCAGACCAGCCGTCGTGCTCAGGAGAAGATCGACCTGAAGTTCATCGACACCACCTCCAAGTTTGGTCATGGACGTTTCCAGACCATCGAAGAGAAGAAGAACTTCATGGTGAGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16344
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011251 None None 403 None 9
ENSDART00000138327 Nonsense 174 188 4 4

The following transcripts of ENSDARG00000003599 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 30019318)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 29737357
GRCz11 3 29868199
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGATTATGATCTGTCCAACAAGAGCAWMAACCCTCTGGTGAGTGTGCTGT[T/A]GTCTCCCTATTGTGAATTTGATAAATTNNGTTTATATGCATGCATTAWTACT
Long Flanking Sequence:
GCGTCAGGCATGGCGCCCGAAACGCATGAGGAAATTTCCCATGCTGCCTTCCTTCTGACAGCACACTTGCCCTTTTTTAGAAGCAAATGCAAACTTGAATACTTTTCTGATCAAAGATGTGTTTCTGTAGGTGTGACTAGCCGTTGGCACACAAAGAAGCTGCCCCGCAAGACCCATCGTGGTCTGCGTAAGGTGGCTTGTATTGGAGCCTGGCATCCTGCCCGTGTGGCTTTCTCTGTGGCTCGTGCTGGACAGAAGGGCTACCACCACCGCACAGAAATCAACAAAAAGGTAATGCTTCAGAAAGTCACTCAAATGTTCATGGCATACGTTTGTGGACGTTTTGTTGCAGTCTTGCCTCATGCATGCTTTTGTTCACCTTTAGATCTACAAGATTGGTGTGGGCTATCATAACAAGGACGGAAAACTTGTCAAGAACAACGCCTCTACTGATTATGATCTGTCCAACAAGAGCATCAACCCTCTGGTGAGTGTGCTGT[T/A]GTCTCCCTATTGTGAATTTGATAAATTGTTTATATGCATGCATTAATACTGATGCCTTTTTATTTTAGGGTGGCTTTGTGCATTATGGTGAGGTGACGAATGACTTCCTCATGCTGAAAGGCTGTGTGGTCGGAACCAAGAAGAGGGTTTTGACTCTGCGCAAATCTCTACTGGTCCAGACCAGCCGTCGTGCTCAGGAGAAGATCGACCTGAAGTTCATCGACACCACCTCCAAGTTTGGTCATGGACGTTTCCAGACCATCGAAGAGAAGAAGAACTTCATGGTGAGTGGATGAGTGCTTAGGTCACAGGACATGTGCAGAGAAGCCATTGTGTCTCTTATCGCAAACAGACAAACCCTGAACGTATTGGTTAATTAAACCGAGTTCAGTGAGTGCATAGCTGCTGCTTGGAGTAATGTCTGAAGTTTAAATTGGTAGCATTAAGCCTCCGGTCGCGTAGAGGTTATGGGCCTCTTGTGTGACGCTGCATTTACTTGG
Associated Phenotype:
Not determined