Busch Lab

ZMP

zgc:77563

Ensembl ID:
ENSDARG00000003584
ZFIN ID:
ZDB-GENE-040426-2248
Description:
platelet-activating factor acetylhydrolase [Source:RefSeq peptide;Acc:NP_998354]
Human Orthologues:
PAFAH2, PLA2G7
Human Descriptions:
phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma) [Source:HGNC Symbol
platelet-activating factor acetylhydrolase 2, 40kDa [Source:HGNC Symbol;Acc:8579]
Mouse Orthologues:
Pafah2, Pla2g7
Mouse Descriptions:
phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma) Gene [Source:MGI Sy
platelet-activating factor acetylhydrolase 2 Gene [Source:MGI Symbol;Acc:MGI:2140321]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa37111 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa37111
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016090 Nonsense 9 444 1 11
Genomic Location (Zv9):
Chromosome 20 (position 35495445)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 35567958
GRCz11 20 35470837
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCTCAATGGATCGCTGTTAACGTCGATGTGTTCTGTTGGCAGACTTGTT[C/T]AGCTGACTCTGGTCAAGAGGGTATATGAATGGTCAAAGTCAACGTCAGGT
Associated Phenotype:
Not determined