Busch Lab

ZMP

impa1

Ensembl ID:
ENSDARG00000003517
ZFIN ID:
ZDB-GENE-040718-245
Description:
inositol monophosphatase 1 [Source:RefSeq peptide;Acc:NP_001002745]
Human Orthologue:
IMPA1
Human Description:
inositol(myo)-1(or 4)-monophosphatase 1 [Source:HGNC Symbol;Acc:6050]
Mouse Orthologue:
Impa1
Mouse Description:
inositol (myo)-1(or 4)-monophosphatase 1 Gene [Source:MGI Symbol;Acc:MGI:1933158]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa31280 Essential Splice Site, Splice Site Available for shipment Available now
sa7262 Essential Splice Site, Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa31280
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site, Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010683 Essential Splice Site None 282 None 9
ENSDART00000131411 Splice Site None 239 None 8
ENSDART00000137933 Essential Splice Site None 20 None 2
Genomic Location (Zv9):
Chromosome 2 (position 26831341)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 27027537
GRCz11 2 26683171
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAACCCGGAAACACAACAATCTGACAGCCTGTCTACATTTCGCCGGTTGG[T/C]AAGCATTTTCTCTCCGTATTATTATTATTATTGGTTGTGTTTCAACGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7262
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site, Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010683 Essential Splice Site None 282 2 9
ENSDART00000131411 Essential Splice Site None 239 2 8
ENSDART00000137933 Splice Site None 20 None 2
Genomic Location (Zv9):
Chromosome 2 (position 26832847)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 27029043
GRCz11 2 26684677
KASP Assay ID:
554-4605.1 (used for ordering genotyping assays)
KASP Sequence:
WGACTGCAATTTRAAACTGAAGAGAATAATTTTTATTTATTTTTTTTTTA[G/A]AAAGGCATCCTAGAATATAAAGGCACAATGCCTGACCTTTGGCAGGATGC
Associated Phenotype:
Not determined