Busch Lab

ZMP

anks1b

Ensembl ID:
ENSDARG00000003512
ZFIN ID:
ZDB-GENE-041210-349
Description:
Ankyrin repeat and sterile alpha motif domain-containing protein 1B [Source:UniProtKB/Swiss-Prot;Acc
Human Orthologue:
ANKS1B
Human Description:
ankyrin repeat and sterile alpha motif domain containing 1B [Source:HGNC Symbol;Acc:24600]
Mouse Orthologue:
Anks1b
Mouse Description:
ankyrin repeat and sterile alpha motif domain containing 1B Gene [Source:MGI Symbol;Acc:MGI:1924781]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa40270 Nonsense Mutation detected in F1 DNA Not yet available
sa20254 Essential Splice Site Available for shipment Available now
sa2161 Essential Splice Site F2 line generated Not yet available
sa16530 Nonsense Available for shipment Available now
sa15624 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26276
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024367 Essential Splice Site 248 1281 6 26
ENSDART00000133509 Essential Splice Site 248 1280 6 26

The following transcripts of ENSDARG00000003512 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 17176869)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18119709
GRCz11 4 18108685
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAACACTAAACATAAAGAATCCAAATTAATATGTTTTTCTCTTTTTATCA[G/T]GGATTGATGCCAACATCAGAGATTGCCAAGGAAGAACTGCACTAGATATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40270
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024367 Nonsense 275 1281 6 26
ENSDART00000133509 Nonsense 275 1280 6 26

The following transcripts of ENSDARG00000003512 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 17176788)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18119628
GRCz11 4 18108604
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAGAACTGCACTAGATATACTTAGAGAACATCCGTCTCAGAAATCACAA[C/T]AAATTGCTTCTCTCATACACGGTAAAGTGTTTCACAGATTTCTATACGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20254
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024367 Essential Splice Site 282 1281 7 26
ENSDART00000133509 Essential Splice Site 282 1280 7 26

The following transcripts of ENSDARG00000003512 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 17175615)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18118455
GRCz11 4 18107431
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTTTATGTTTGTCTGTTTATTGTATGTTAATAAATTGTTTTTCCCTCT[A/G]GATTATATGATGTCAGATTGTGACAGAGGGAATTTTCACGAAGACTTAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2161
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024367 Essential Splice Site 423 1281 10 26
ENSDART00000133509 Essential Splice Site 423 1280 10 26

The following transcripts of ENSDARG00000003512 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 17153738)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18096578
GRCz11 4 18085554
KASP Assay ID:
554-2938.1 (used for ordering genotyping assays)
KASP Sequence:
CTATATATTTATCTGTTATGACTCTATTTTCTGTCATSTTGTCTGTTTGC[A/T]GGACAAGCGATGTGTTGAAATTGCCCATTCTCCATCACTGGATGTGTTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5259
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024367 Essential Splice Site 472 1281 10 26
ENSDART00000133509 Essential Splice Site 472 1280 10 26

The following transcripts of ENSDARG00000003512 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 17153585)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18096425
GRCz11 4 18085401
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAAGCCCTGCTCTCTAGACATCAACCTTCACAACGCCTGTCCTCGCAACG[G/A]TTAGTAACTGCWAATCGATGGAGGAAAAAAANNNTCAATCAGCAGGTGGCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16530
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024367 Nonsense 725 1281 13 26
ENSDART00000133509 Nonsense 725 1280 13 26

The following transcripts of ENSDARG00000003512 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 17067417)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18010257
GRCz11 4 17999233
KASP Assay ID:
2259-4806.1 (used for ordering genotyping assays)
KASP Sequence:
GGAGCAACTGCACAGGTGGCTCYAKTCCAGCAAACAGYAATACAGGCTAC[G/T]AAGAAAGAGCCTGCACTCTTGGGAGGATGAGGTCTATGCCAAAAAACGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15624
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024367 Nonsense 877 1281 16 26
ENSDART00000133509 Nonsense 877 1280 16 26

The following transcripts of ENSDARG00000003512 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 17045893)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 17988733
GRCz11 4 17977709
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGTGGAGGACCAGGACCTGCTGGAGATTGGGATTTTAAACTCTGCCCAC[A/T]GACARCGACTTCTTCAGGCTATTCGCCTTTTGCCCAGGGTGAGTAGAGAC
Associated Phenotype:
Not determined