Busch Lab

ZMP

dye

Ensembl ID:
ENSDARG00000003487
ZFIN ID:
ZDB-GENE-990415-46
Description:
Nuclear pore complex protein Nup93 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZU29]
Human Orthologue:
NUP93
Human Description:
nucleoporin 93kDa [Source:HGNC Symbol;Acc:28958]
Mouse Orthologue:
Nup93
Mouse Description:
nucleoporin 93 Gene [Source:MGI Symbol;Acc:MGI:1919055]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa43076 Nonsense Mutation detected in F1 DNA Not yet available
sa23272 Nonsense Available for shipment Available now
sa36620 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa43076
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025782 Nonsense 252 820 8 22
ENSDART00000100261 None None 110 None 4
ENSDART00000147839 None None 110 None 3

The following transcripts of ENSDARG00000003487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 17224038)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17575804
GRCz11 18 17564870
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTGGTGCCAGCAAAAGACACTCTGAAGAGTCGAGTGTCTGTGGACATG[C/T]AGATGGCCTTCGTCAGACAAGCCCTGCAGTTCCTGGAGAACAGGTGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23272
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025782 Nonsense 509 820 13 22
ENSDART00000100261 None None 110 None 4
ENSDART00000147839 None None 110 None 3

The following transcripts of ENSDARG00000003487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 17228475)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17580241
GRCz11 18 17569307
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGTTGCTCTGGTGCTGTACGAACTCAAACTCCTGCTCAAATCATCAGGA[C/T]AGAGCGCTCAACTCTGTAAGTTGTGACTATTGAGCGTTAAGTGAGAACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36620
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025782 Nonsense 723 820 20 22
ENSDART00000100261 None None 110 None 4
ENSDART00000147839 None None 110 None 3

The following transcripts of ENSDARG00000003487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 17235468)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17587234
GRCz11 18 17576300
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTTTCTCCAATTCTGTGTCAGGTGATCGAGAGGCTCAAGTTGGTTCCCT[T/G]AAGTCAGGACAGTGTTGAGGAGCGAGTTGCTGCCTTCAGAAACTTCAGCG
Associated Phenotype:
Not determined