Busch Lab

ZMP

NP_957396.1

Ensembl ID:
ENSDARG00000003449
Description:
cAMP and cAMP-inhibited cGMP 3',5'-cyclic phosphodiesterase 10A [Source:RefSeq peptide;Acc:NP_95739
Human Orthologue:
PDE10A
Human Description:
phosphodiesterase 10A [Source:HGNC Symbol;Acc:8772]
Mouse Orthologue:
Pde10a
Mouse Description:
phosphodiesterase 10A Gene [Source:MGI Symbol;Acc:MGI:1345143]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa35407 Nonsense Mutation detected in F1 DNA Not yet available
sa38918 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa28054 Nonsense Mutation detected in F1 DNA Not yet available
sa17787 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28053
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007500 Essential Splice Site 232 843 8 23
ENSDART00000144312 Essential Splice Site 211 734 7 20
Genomic Location (Zv9):
Chromosome 13 (position 4244569)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 4461489
GRCz11 13 4589985
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTTGCGGATCATTTGCTAAGTGTAATGTTCTTTCATTGTTTGTTTGTTT[A/T]GGTTGCAACAGCAAATTTGGCCTGGGCATCTGTAGCCATACACCAAGTCC
Long Flanking Sequence:
ACAGCAGCATGACTTTATATTCTATACTGGACATTATTTCTGTTCAGTGACATGACTTTTGTCTAAGCAGACAAACATAATGTGAAGACTAGAAGTGTCTTGAAAAATATCTAGTCAAATATTATTCCCTGTCATCATGACTAAGATAAAATAAATCAGTTATTAGAAATGAATTATTAAAACTATTATGATTAGAAATGTGTTGAAAAAATCTGCTCTCCGTTAAACAGAAATTGGGGGGGGAAATAAACAGAGCGCTAATAATTCAGGCGGGCTAATATTTCTGACTTCAACTGTATACTACAAACATTTACACTATATAGAGAGTAATATTGAGCATAACTCTCCAGCTAATCCATAACCCCACAAAATCAGAGCTAAAAGGCCATTTCTGTAAATAGTAATAATAAATATGTAAATAGTCTCTAAATTAAACACTTCTTGTTTGCGGCTTGCGGATCATTTGCTAAGTGTAATGTTCTTTCATTGTTTGTTTGTTT[A/T]GGTTGCAACAGCAAATTTGGCCTGGGCATCTGTAGCCATACACCAAGTCCAGGTGAGAATGTTTCAGAATCATAATCATTAAACCTCGCTCATTGTTAGATAGTGATTCTCTTGCATAAGATGTTTGATTTGGTTGTTTTGATTTCTGTAGTCCACTGTGTACATGTATAAGGCTGCTGGTGGGCCCAGTGTAAGCAACCAGACCACACATTAAACACACCCTGGTCTCTGGAGGTGCAATTAATGACAGTGCAGTCTTGTTTGTACGTACATTGTTGTATACCATGAATGACACCTCTCTCCTCTCTGGGTGTTAATGTCCCTGTGCATCATAAGGCTCTTTGGGAGCGATTCTCTCTGCAGCGCAAATCTTCTCAGAAGGCAAGGAGCATAGTAGAGAGTAAAGATCACAAGTAATATATTTAATAAAAATGCCTAAAATATATATATATTTTTAGAATAGACTTATTTTAAAACTCCATTAAACAGATGAGAATGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35407
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007500 Nonsense 372 843 13 23
ENSDART00000144312 Nonsense 351 734 12 20
Genomic Location (Zv9):
Chromosome 13 (position 4255699)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 4472619
GRCz11 13 4601115
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTAACATCTGTTCTGCTTTTCATAGAGAAGTAGATCTCTACACTGGCTA[C/A]ACGACGCGGAATATCCTGTGCATGCCCATAGTCAGCCGCGGGACTGTGAT
Long Flanking Sequence:
ATAAATCATGCATTGGAAGCTGATTTGAACTTTTACCCCCACAGGTTTTCGATTGAGAAAGGAATAGCAGGTCAAGTGGCCCGAACAGGAGAAGTTTTGAATATTCCGGATGCCTATGCAGACCCCCGTTTCAACAGGTAGAACTTTCATTTATCACATAACATTTGTGACCCTGCACACACAAAAATTGTCTTATCATGCACGAGAATTACTAAAATACTTTGCATGAGTCAAAAATAAATGTTTATTATATTATTAAGTAAACATATATATAGATACTTTGAAATACATCAAAACTTTTTTTTGTTTAGAAATATGCACTGCCAAGAACTTAATGTGGACAGCTTTAAAAGTAATTTTCCCATAATTTACTGTAGATTCCCATTATTTACCCTCCTGTCCTTTTTTGTCCTTTTGCGGTGTGTGTGTATTTGTGTCTGTGTGCATTTCTTTAACATCTGTTCTGCTTTTCATAGAGAAGTAGATCTCTACACTGGCTA[C/A]ACGACGCGGAATATCCTGTGCATGCCCATAGTCAGCCGCGGGACTGTGATCGGTGTTGTACAAATGGTGAACAAGCTGGGAGGAAGTGCCTTCACTAAAACTGACGAGAACAACTTTAAGATGTTCGCCGTCTTCTGTGCTTTGGCCTTACACTGTGCAAATGTAAGTGCGGACCTACAGTCTGATCAAACAAAACAATTCACTTATTATGTAAATGAATGATTTTACATTGTACTTACTAAACAAAATAAGAAAAAAATATACTATTTTTACTATGCTATTGAACTTAACCCTTGTGTATTGTTCAAATTAACTACCCTTTCAGTATGTTTGGGGCTGTTTTTACCCCATTGACTTTCATTATAACGACATTTTGTAGATTGCAAATGACAGCATATAATCATGCATTCTTGATTGTTGGTGGTTTTTCCTGTTAGTAAGAGGTCAGATTTGTTATTATTACTGTTGATCATCCAGCCTGATCTCACAAGGAAACGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38918
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007500 Essential Splice Site 427 843 14 23
ENSDART00000144312 Essential Splice Site 406 734 13 20
Genomic Location (Zv9):
Chromosome 13 (position 4256743)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 4473663
GRCz11 13 4602159
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACATTTTGCATCTGCGTAAAAGACACATGGGGCGTTTGTGTTTGTGTGTA[G/A]ATGTATCACCGGATAAGACATTCAGAGTGCATTTACCGGGTGACCATGGA
Long Flanking Sequence:
AAACTTTGCAATCAAAAAATGTCATTACAATGAAAGTCAATGGGGCAAAATCGTCCCCAACAAAAAAAAGGGTAGTCAATTTTAGAGTGTATTGTTGAGTTTTTGAAAACTTTCAAAGCATTTTCCTCAAAATAATTGTCAAAATAAGAATTGTCACCAAGAATCCTTCCATTTACTGAAACAAAGAGAAAGTTGTGACTAAATTAAGACTCAAAATCACCTCAGAGTGGTTGAAAACATCCACAACGGCCCATAAGGGTTAATAGTGTGGTGTCATTTACCACTAGTAAAAAGAGGAAAACATTGATTGTCTGTACAGAACTGTAATTCTGTTAACGTGAAAACACTCAATTATTTTTCTAGCTGAATAAAGAACGATATTAAATAAGAAAAATATTTATGACAGTGAATGCAAGCGCTGTTTTCCAATGGTTCCGCTATTTTGCATGTACATTTTGCATCTGCGTAAAAGACACATGGGGCGTTTGTGTTTGTGTGTA[G/A]ATGTATCACCGGATAAGACATTCAGAGTGCATTTACCGGGTGACCATGGAGAAGCTTTCGTACCACAGCATCTGTACGTCAGAGGAGTGGAAGACCCTCACTCAACTCACCCTCCCTTCAGCCATATATAAAGAGATCGAACTGTGAGTTTTACTCTCTCATATATGATACATCAATCCCACATAATGGAATACACATGCTAAAATGCTTTTCTTACTTAATAGTTACTCGTTTTTGTCTTGTTTCTAGTCCAAATATCCAAAAATACTTAAGTCGAGAAGCATTTTCTAGTTTTGTATTGAGAAACGTGTCAAAATTAAGTGAGTTTGTTCCCTTAAAACAAGCAAAATAATCTGCCAACATTTAAATAATGGATTGTGTTTGTATGTGTTTTAACTATTCTTAAACTTAACCAGTGTGTATTGTTCAAGTTATATGCAATTAAACTGCTCTGAATCAACAGATTGAGGAGTTTGGGGTTATTTTGATAGTTCTTCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28054
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007500 Nonsense 742 843 21 23
ENSDART00000144312 Nonsense 722 734 20 20
Genomic Location (Zv9):
Chromosome 13 (position 4269760)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 4486680
GRCz11 13 4615176
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGTGGGGTTTTACAATGCAGTGGCTATTCCCTGTTACACCACTCTGTCT[G/T]AGCTGTTTCCTCCCTCCGTTCCTTTGCTTGAAGCTTGCAGGTAAGTTAGT
Long Flanking Sequence:
CCATTCCACCTAGCCTGCTTTACTGAGCAGAAGTTGCTTTTATATTCACATTGGGTTATTTCTGAGCAATGACATCCTGTGACGTGCTACCTATATTGTTTACCGCTACGATATTCGCTATGAAATAGCATGTACGTGTGGCTTAGTAATAAGTGAAATTCCTGCACGCCGCTGGCCAAGCACTATGACTTGAACTAGTGGGTTGTCTGCTGTCATGTCGCGGTGCGCGCGTTCACGAATTCTGGATGCGTGGCTTTAAAACACAGTCCCTCCCCTGCCGTCCAGAGCTAACATATTAACCGATTAACATTTTGGCAGATCACCTACTGCACCTTTAACTGTTATGTTTAGTTGTAAATCCATCATTAGGATAGCTTTTATGTTTTGTTGTAGAGTAAATGTTAAATGGACGTTTAGTTATACTATAGTCCTGTTTTTCCCCATGTTCTCAGGTGGGGTTTTACAATGCAGTGGCTATTCCCTGTTACACCACTCTGTCT[G/T]AGCTGTTTCCTCCCTCCGTTCCTTTGCTTGAAGCTTGCAGGTAAGTTAGTCCGAGACATTTAACACTAAACTAATTATAGAGATTTATATTTATGAATCAGTTTAACATCACAGTACTGGGATGAGTACATATAATCAGTTCATACACACATCAGTTATTTAAAACAACTTGTATTTGCCAGCCATAAAAACGATATACTCGAGCTTAATGAACTATATTACTGAGAGGAAGCGTAGCGGATTTGTGATTTTAATATCATTTGTGCATGATTTAAATGTGTTAGTTACAGAATTACACTAAAAACTAGTTCCATTAGCCATTAGTTGGACCCAATATTTCAAAACTAAAAACTAATAATAATGAATGCACTCAATAAACCAAAGATTGTATTTATGGGTAATTCTTCAACTACGGGCACTTTTATGTCCTTTGATCATATATCCAAAAATATATATCATTTCATTCAAGTTTCTCTTTGTTTGTCAAACTAATAATAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17787
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007500 Nonsense 837 843 23 23
ENSDART00000144312 None None 734 None 20
Genomic Location (Zv9):
Chromosome 13 (position 4274986)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 4491816
GRCz11 13 4620402
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTGCAGAGACGGGAGGAAGTGCAGAGGGCAGGCGGACGAGGATACTTTC[A/T]RAAAAAAAATAAACAAAACATAATGTTACCTCAGYGGGTGATGGAGGCGC
Long Flanking Sequence:
TTCCTCAGATTTTAGTTCATATTGACATGCTCAAAAATGACATTGTTTCATTAATTTTACAACATTGCATGTACAAAGATCTGAAAGGGGTTTGATATCAGAACATATTACCTACCAATTAAAATTGCATTATTTCAATCAATCAATCAATCAATCAATCAATAAATCAATCAATCAGCCAGTAGTTTAAACTGGAGAAATTGCTGTTACTTTAGTCTTATTGCAGTCTTGTAAAGAATGCTTTGTGTTTTTCAGGGAAAACCTGTCCCAGTGGGAGCGCATTGTGCAAGGGGAGGACGTCTCTGCGTGGTCATCAACCGAGGAGGCTGAAGTGAGCGAAACATCAGACAGTGGACCAGTTAAAGTGGACAACTGAATCTGTGGCACCTTTCCCACAGCACCACCCACAACCTGCCAGAGACACTGGACTTCCTGTGGACAGTCCCACTTCCTGCAGAGACGGGAGGAAGTGCAGAGGGCAGGCGGACGAGGATACTTTC[A/T]GAAAAAAAATAAACAAAACATAATGTTACCTCAGCGGGTGATGGAGGCGCACACTCTAATGACATCAGGGCTCCCTTGTTGATGGCTGGGACTCAAGTCCGGTTCAGCAGAATGGGCGTCATTATTGGCAGTACTTTCCCTTAAGAGGTTGCTTTCTTTTAGGCTTTCTTTTTCAGTTTATTTCGTGGTCTTACGTTTTGAAGAGGCCTTAAAAACGAACCCGAGTTACGATCTGACTCGTAACCAGAAGACGGTTCGTCTAGTTTAATATGGTACATTTTATCCTGCTGTGGTCGAAAACGTTGTACGCGAAGCTACTTGAGTGGATTTCTTTTTTTAAAGATAGACACAAGGAATGTTTAGTCAAAGTTAAGGTGCATGAGGCACAAAAAAAACATCGTTCTGGTGGATGTTTTCTATCATATTTTGAGCAAAGCTGTTTTGCAGTACTTGAATGAAGAAATACAGCCTATTCTGAGTGGAGATGAAAACAAAAAATC
Associated Phenotype:
Not determined