Busch Lab

ZMP

col4a3

Ensembl ID:
ENSDARG00000003395
ZFIN ID:
ZDB-GENE-070802-4
Description:
Type IV collagen alpha 3 chain [Source:UniProtKB/TrEMBL;Acc:Q58FS7]
Human Orthologue:
COL4A3
Human Description:
collagen, type IV, alpha 3 (Goodpasture antigen) [Source:HGNC Symbol;Acc:2204]
Mouse Orthologue:
Col4a3
Mouse Description:
collagen, type IV, alpha 3 Gene [Source:MGI Symbol;Acc:MGI:104688]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa12489 Nonsense Available for shipment Available now
sa22698 Nonsense Available for shipment Available now
sa42602 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28511
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049849 Nonsense 381 1664 21 52
Genomic Location (Zv9):
Chromosome 15 (position 35359739)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 36233930
GRCz11 15 36091899
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAAATGTTAACTTCCTCCTTTTTAAAATATGTTAGGGACCCCCATACAA[G/T]GACCTAATGGAAAACCAGGTCTACCAGGGTTTAAAGGTTTGAAAGGGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12489
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049849 Nonsense 538 1664 25 52
Genomic Location (Zv9):
Chromosome 15 (position 35362174)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 36236365
GRCz11 15 36094334
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACAGGTTTTCCAGGGCCTTCAGGCCCCAAGGGAGAAATGGGGATGAAATA[T/A]GAGATTGGGRAAAAAGGCTTTAAAGGAGACACTGGTGCAGTAGGACTRTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22698
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049849 Nonsense 823 1664 32 52
Genomic Location (Zv9):
Chromosome 15 (position 35366134)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 36240325
GRCz11 15 36098294
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCCCTCAATGAAGGTCACTGGGGCACATACTGTATATTGTTTTTAGGTT[T/A]GCCAGGTTTGAAAGGGCCACAAGGTGAAACTGGACTACCTGGATTGAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42602
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049849 Essential Splice Site 1105 1664 39 52
Genomic Location (Zv9):
Chromosome 15 (position 35368989)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 36243180
GRCz11 15 36101149
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTCTTTTTTATTAAATAACAATATTTTGTTATGTATTGTGATTTTTATC[A/T]GGACCCCCAGGAGAAGCTGGTGATGATGGGTTTGATGGATTTCCAGGTCC
Associated Phenotype:
Not determined