Busch Lab

ZMP

si:dkeyp-35f12.3

Ensembl ID:
ENSDARG00000003317
ZFIN ID:
ZDB-GENE-090313-385
Mouse Orthologue:
2610034M16Rik
Mouse Description:
RIKEN cDNA 2610034M16 gene Gene [Source:MGI Symbol;Acc:MGI:1916489]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa14906 Nonsense Available for shipment Available now
sa16032 Essential Splice Site Available for shipment Available now
sa45392 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa1031 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa14906
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003775 Nonsense 214 1215 2 12
ENSDART00000132166 None None 141 None 3
Genomic Location (Zv9):
Chromosome 10 (position 7622091)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 5632056
GRCz11 10 5632360
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACAAAAATCCCCAAATCTACTCATGGAYTCAACATGGAGCACATTACCAA[C/T]AAAATGTMAGCTATAAGATTAGCATCGCAGAGCTAAATGSGGAGTCGTCA
Long Flanking Sequence:
AAACGGACTCTTTCTGTAAAGAACATATAGTGTCAGAGTCTGAAGATGAGAAAGAGACAGAGGCTCCAAGCATGGAGAAAGAAAACGAATCCACGAGTAATGAAGATTTCTTCGAAGACAGACAGATGAGGGACAGGCAAATGCCAATCTCAGAATCAGTGAGCAGAGATCCGGGGTTGAAGATAACTCATTCACTGACCTTCGATAATTTTGGACTGACTTCTCCCAGAGTTGTGTTTGAACGGTGCCATGAGGCTCCTCTAGGAGGAGCAGTTAGCAGTGTGATAGCTGTTACAACCACTGAGGTCAAGTGCATGGGCCCGAACGTGAGGCTTGAGATCAGTGAAGTAGTGACGTCAGATGATTCAAACTTCAAGACGACCGTTACCTTTCAAAACGACAGAGGAGAAGAGACTCATTTCACAAGCCGAATGGAGAAACATCAGAATCACAAAAATCCCCAAATCTACTCATGGACTCAACATGGAGCACATTACCAA[C/T]AAAATGTAAGCTATAAGATTAGCATCGCAGAGCTAAATGCGGAGTCGTCATGCGCTTCCAAGAGCCAGAGCTCATGGGATGATCCTGAAGAAGTGGCTTGCCGTAAAAGCTGCTGTAAAAATAACTTTCATTGGGGTGGCCAAACTGACACTGATTTCACTCTGGTCGATGGATCTTCCCGATGTTCATCGCTCTCAGATTTTTGGCAACGTCAGAAACAGCCATCACTGCCTACCAGCCCCAGTAATGAGGCATTATGGGATATCCCTCCACCTGAACAATTCGCTGATGGGAACAGCAGTGCATTGGATGTTCTTGCAGAAAATGTTGCGTCATGTCAGATCAGTCCCAGAGAAAACTTCATTAACCAAGACAACATCAATTGCACACAAACAGCGTCTGAGGTCCCCTTATGCAAAGAGTTTATCCGCCAGAATACATTGGAGGAGAATAATGAGCCAAGGTACTGTGAAGAACTATCTGAAGCAAGTCCTCATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16032
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003775 Essential Splice Site 877 1215 4 12
ENSDART00000132166 None None 141 None 3
Genomic Location (Zv9):
Chromosome 10 (position 7629854)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 5639819
GRCz11 10 5640123
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCAGAACGACAGTCCACACTGCCTCAGAAGCTGTGCTYGACCAGCAGCWA[G/A]TGAGTCCTTAGCAGACYAATATAAAAATAWGCTAGAACTGACTATTTATG
Long Flanking Sequence:
ATCTGATAAAAAATAACATTTTATTTGTGTTCCAACGCTAAGTGAATGTCTCAGGGGATTGAAACAACATAAGAGCCAGTAATTAATAACAGATTGTTAGTTTTTTGGGTGAACTAATCCATTAAATTCCATTTAAATTCATTCAGAAAGAAATATATGAAGTAGACACAATTAATGTATATTTGCTGCTCTGCTGCCAAGCCATAACATGCAATACAAAAAGCTGAAAAATCTAAAGTGCTCTAGCTGAAAAAACACTAAAATAGATTTAACAAAAAACGAATTGAGTGCTGTTTTGAATATTGTTTTCTGTTTGTTTCATCATTTAGACACAATGAACTCTGAGGACACTCGTTCGGTGGATATGTCAATGCGAGATATTGAGGACAGAGGATTTTACACTGAAACATTTCACTCAGTTTCATGGATATACCATGGGGCTGAGGTCACCCAGAACGACAGTCCACACTGCCTCAGAAGCTGTGCTCGACCAGCAGCAA[G/A]TGAGTCCTTAGCAGACTAATATAAAAATAAGCTAGAACTGACTATTTATGATTTACAGTGTTTAAAGATGCATTTCTTTATACATTTCAGTTCGTGAGCGGACAGTAAAAATCTGCAAAGGTGTGGGCGAGTATCCCTGGGGCTTCAGAATTCAGTTCTCCAAACCCATAGTGGTTACTGAAGTGGATACAAGTAAGTCATTAATATTATATATCCAAACTCTAATGCACAAAAGCAAATATGTCTGTAAAAACGATTAGAAATTCACTGAGGGTTATATTTGATCTTCATTCTTGATTCTTTATACCAGTGGTTCTCAAACTTTTTTCACCAAGTACCACCTCAGGAAAAAATTGTCTCTCCAAGTACCACCATAATCACCAGTATTGAAATAAAGTAGCATAGTTGGCCAAATTAAGCAGCTACAGCACTGCACAGTTTGAAAAGGAGTCATATTCATTGAACGAAATTATACTCCATACAAAATATGACATTTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45392
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003775 Essential Splice Site 1008 1215 7 12
ENSDART00000132166 None None 141 None 3
Genomic Location (Zv9):
Chromosome 10 (position 7634249)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 5643869
GRCz11 10 5644518
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTTCGTGCTCAGACATGACTGCTGCCTCTACTACTACAGAAACAAGCGC[G/A]TATGTTCAGCTTCTTCTTCTCCATGTTTTTGTCTTGTTGGAACATCTGAA
Long Flanking Sequence:
TGACCAGCCTAGCCAAGCTGGGAGTCCAGCCAAAACCAGCTATGTCTAGCTTAAACCAGGCTGGTCAAGCTGGTTTTAGCTGGATTTGGCTGGTAATTTTCCAGCCTGACCAGCTAAGACCAGGCTGGAAATGGCTGGAAACTAGCCTGGAAATGGCCAAAACTCCTCTAAAACCAGCCTTGTCAACCAGCTAAAACCAGCCAACCAGCCTAAGCTGGTTTAAGCTGGATTTTTCAGCAGGGAAATTGAATCGTGTAGGTTTCAACTAGGGGTTTCTAGCTTCATGAACTCATTTTGTGATTTCTGGTTTGAATTATGAAGGCCCAGACCTTTTAACTCTCACCATCGGCTCGGATATTGGTCGAACGCCCAACACTCCACGTCCCGCGTGCAGGGGCTACTTACATAAGCGAACACAGTCGAGTTTCCTGAAGGGCTGGAGAAAGAGATGGTTCGTGCTCAGACATGACTGCTGCCTCTACTACTACAGAAACAAGCGC[G/A]TATGTTCAGCTTCTTCTTCTCCATGTTTTTGTCTTGTTGGAACATCTGAAATAGAATGACATACGAAATGAAGCTTTTGTTTTTCCTGCACAGGATGAAGGGAAGAGTCGGGCCTTGTCTGTGATGAGTCTGGAGGGGGCGCTGGTGGAGGCTGACAGCACTTTAGGAAAGCCCTTCGTCTTCAGATGCTGCCCTGTTTCTGGCAACAGAGCTTACTACTTGTGTGCTACATCAAACCAGGAGATGAAAAGGTGAGAACATGCCATGCTTTTTGAGATGAAGAGGTCAATTTGTATATTTGATAACAATTTACAATATGAGGGCACTTGGGAGTAAGGGTGTCACGATTTCGATTTTAAATCGAAATCGATCGAAATTTATACTTAATTTTGATTATCGATTTAAAAAATAGAATCGTCGATGCTGCCACACCCCCATGTCACGTCAGCTTGGCTTGCCAAGCGGGGAAAAAAAGACGCTTGTTGAAGAGCTTGTTAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1031
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003775 Nonsense 1079 1215 10 12
ENSDART00000132166 Nonsense 5 141 1 3
Genomic Location (Zv9):
Chromosome 10 (position 7640546)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 5650166
GRCz11 10 5650815
KASP Assay ID:
554-0935.1 (used for ordering genotyping assays)
KASP Sequence:
TAATACTCATCRTGTTAATGTTGGTGCTTGTCATGGCAGAATCACGTGTG[G/A]GTGGACGTCACTCGGCACAACTCAAATCTGCCCCCGCTGGCGGTCAAGAA
Long Flanking Sequence:
TGGCCAGAAAGTGATTCATTTTTTATAAATTGTTAAAATTTTGGTATTTGTTACGCAGCAAGCCCAGAGATTGTTGTGTAAACTTTATATATAAATAACTTTAATGTGTGATATGAATAAAAAGTGATCATAAACAAACAATTTCTCAACTCAAATGAGGGGCAGCTTGGACCCGGAAAGAGTATTACATACGTCACCAACACGTCATCACTTAACAAGCGGATTCACTCCAGTGCATTGAATTTTTAGAAAATAAGGCACACTCAAGGTTTGTGCATTATTTTATATTTATTCAATGGCCCGTTGTCAATTATCCCTTATATGACTACTAGTGCTCTGCAATTAAGAGGTTTTAGGAAAGATGAAATCGCTTGATTGGATTGATGTATGAAATCTCTTGATTGGATTAGTGAAAGCACAATGTAATATCAAGTGTAAACAGGGTCATGGTAATACTCATCGTGTTAATGTTGGTGCTTGTCATGGCAGAATCACGTGTG[G/A]GTGGACGTCACTCGGCACAACTCAAATCTGCCCCCGCTGGCGGTCAAGAACCCAGAATGCCTTGGTTTGCTCCATCAGCTGGACAGAAGCAAAGACTCATGGGTGCAGTACTACTGCGTGCTGAAAGACGGATGCCTCTATTTCTACGTCAGTATTCGTTCAACATCCGCCATAGGTATGTTAAAGAAATGTTCATGTTTCTGATAATGTTCATGTTTCTGAAAATCTGATACATGTTACAAAATTATTCTTAATATATTTAAACTAACACAATATCACGGCAACTCGTAACTTTTTGATTTAGTGGCTAATTCGTATGAATTCGTATGACCTTATTCGTACAATTAAGTACGACTTGCTCATCCCCCAATGACGGTTGGGTTTAGGGGTGGGGTTAGGTGCCACGCTTCCTTTTTAAAATCGTACAATTTCATACGACTGAACTCGTACAAATTCGTACGAATTAGCCTCTAAACTGGCAAAACGTAAAATATTTACGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7642
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003775 Nonsense 1195 1215 12 12
ENSDART00000132166 Nonsense 121 141 3 3
Genomic Location (Zv9):
Chromosome 10 (position 7644777)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 5654097
GRCz11 10 5655046
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TWCGATTTCTCTAGATGGATCAGTGCTATTAAATCCTCTATAAMAAAATG[G/A]CTGCCACTGCATCAAGCAATTCAAGACTACATGAGTCGGCCAGCCGAGGA
Long Flanking Sequence:
GGTTGACCAGCCTGGTTTTAGAGGGTTTTTGGCCATTTCCGGGCTGGTTTCCAGCCATTTCCAGCCTGGTCTTAGCTGGTCAGGCTGGAAAATTACCAGCCAAATCCAGCTACAAGCGACTCCCAGCTTGGCTAGGCTGGTCAAGCTGGTTTTAGCTGGTCATTTTCCAGCCTGACCAGCTAAGACCAGGCTGGAAATAGCTGGAAACCAGCCTGGAAGTGGCCAAAACCCCTCTAAAACCAGCCTGGTCGACCAGCTTAAACCAGCCAACCAGCCTAGGCTGGTTTAAGCTGGATTTTTCAGCAGGGCTGCCATGTGATTGGCTGATCTGATATTTGTATTAAAGAGCAGTTAAACAGGTATAGCTAATGAAGTGTGAAGTTGACATCTCCAACAGCCAGACAGTGAAATATTAAGATTATTCTGATGAATTAACACCATTCTTCTCTCTACGATTTCTCTAGATGGATCAGTGCTATTAAATCCTCTATAACAAAATG[G/A]CTGCCACTGCATCAAGCAATTCAAGACTACATGAGTCGGCCAGCCGAGGAAACGAGAATGTGAACAAGACTGACCTCGATTCTGCCAGCGTTGATGACATGATGGTGAAGATCCTATGCCTTACAGACAAATCATACTACTGCGTTTCAAATCAGCTGGACACTTTACTACCCAATTCAATGCAATACCCAATACAATTTTACAGTTTGACAAGTTGGTGGATTTAATCAATCCATATTAGGCAAAAAAGCCGCCCTAAACATAACTAATATTAAACAGCACAGATCAAAGAAAGTGTAGGAGTCAGTGGTGTGTGAGCTAAATGGGTTAAAACGTGCAAATGACTGCAGAAATTACCCAAAATTTGAAAGAGTTGAGATAAGAATTGCTAGATTGTGTTGAGTCTTTAAGGTTTTGATAGACTTCATGGTTTTGATAAACTAGTTGTTGATTAGATCATGGAACTGACTCTGAATTTGAGTAATTACACTCCATAAATG
Associated Phenotype:
Not determined