Busch Lab

ZMP

btbd7

Ensembl ID:
ENSDARG00000003069
ZFIN ID:
ZDB-GENE-030131-4477
Description:
BTB/POZ domain-containing protein 7 [Source:RefSeq peptide;Acc:NP_001020722]
Human Orthologue:
BTBD7
Human Description:
BTB (POZ) domain containing 7 [Source:HGNC Symbol;Acc:18269]
Mouse Orthologue:
Btbd7
Mouse Description:
BTB (POZ) domain containing 7 Gene [Source:MGI Symbol;Acc:MGI:1917858]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa37046 Nonsense Mutation detected in F1 DNA Not yet available
sa37045 Nonsense Mutation detected in F1 DNA Not yet available
sa23720 Nonsense Available for shipment Available now
sa39283 Nonsense Mutation detected in F1 DNA Not yet available
sa39282 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa37046
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020710 Nonsense 21 1077 1 10
Genomic Location (Zv9):
Chromosome 20 (position 27182042)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 27253345
GRCz11 20 27152435
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGCCTCCAGCTACCCTCACTCGTGCTCCCCTCGATTTGGGGGAAACCCA[C/T]AGACCCAGCAGACCTTCATTGGTAAATGCTATTACTGAGACATTTGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37045
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020710 Nonsense 128 1077 2 10
Genomic Location (Zv9):
Chromosome 20 (position 27180287)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 27251590
GRCz11 20 27150680
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGAGCTCAGTCTGCAGGCGGGCTTGGCCCGACCTGAAGCTCGAACCCTA[C/T]AGCGTGATTTGGCTACCCTTTATCAGCACAAGTACTGCACTGACGTGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23720
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020710 Nonsense 405 1077 3 10
Genomic Location (Zv9):
Chromosome 20 (position 27158312)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 27229615
GRCz11 20 27128705
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTTATGTCTAAATAAAATGTGGTGATGTTGTTTATCTGTCTTAGGCTGT[G/T]AAGACATTGTGGCAGACAGCATCTCTCTGGACTCGGTGGTGGCCATCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39283
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020710 Nonsense 594 1077 6 10
Genomic Location (Zv9):
Chromosome 20 (position 27151876)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 27223179
GRCz11 20 27122269
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGCAGAAGAGTGCTGGCATTTATGTGCGCCCACGCCTCTTCTCTCCTTA[T/A]GTGGAGGAGGCCAAGGTAAGATACTCTTTCTCACCTCATCAGAACATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39282
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020710 Essential Splice Site 600 1077 7 10
Genomic Location (Zv9):
Chromosome 20 (position 27149926)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 27221229
GRCz11 20 27120319
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTAATTACTGTTATCACTTGCATCAAGCCTTGCATACATGTGTTTCTCC[A/T]GGCGGTTCTGGAGGAGATGATGGTTGAGCAGACCGATCTGGTTCGGTTGC
Associated Phenotype:
Not determined