Busch Lab

ZMP

fgfr1op

Ensembl ID:
ENSDARG00000003058
ZFIN ID:
ZDB-GENE-090417-1
Description:
FGFR1 oncogene partner [Source:RefSeq peptide;Acc:NP_001002125]
Human Orthologue:
FGFR1OP
Human Description:
FGFR1 oncogene partner [Source:HGNC Symbol;Acc:17012]
Mouse Orthologue:
Fgfr1op
Mouse Description:
Fgfr1 oncogene partner Gene [Source:MGI Symbol;Acc:MGI:1922546]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa43468 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa23732 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29386
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010494 Nonsense 81 511 4 19

The following transcripts of ENSDARG00000003058 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 30608676)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 30679889
GRCz11 20 30582768
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGGCGTTTGGTAGCAGGTCTTATTACTGACTTTCTCCAAGTCTTCAATT[T/A]AGACTTCACCCTTGCTGTGTTTCAACCTGAGATTAGCACGGTACGTCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43468
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010494 Essential Splice Site 140 511 5 19

The following transcripts of ENSDARG00000003058 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 30609028)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 30680241
GRCz11 20 30583120
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCTGGTGAAAAGGGGACGACACAGGGAAAAGACCTCCATTTTCACAGAG[G/A]TGACCTTTAATGAGCTGCATTTCAGCCAGTCAGATCAGTCCCCTGCCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23732
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010494 Nonsense 452 511 17 19

The following transcripts of ENSDARG00000003058 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 30631756)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 30702969
GRCz11 20 30605848
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCACTCTTTTCATTTCCAAACAAATGCTTTGCAGATGATGATCTTGACTA[T/A]GATGACGACTTCAACAGGTAAATACATTGTCCGACTAGTGTTTTGCAGTT
Associated Phenotype:
Not determined