Busch Lab

ZMP

sorbs2a

Ensembl ID:
ENSDARG00000003046
ZFIN ID:
ZDB-GENE-070308-2
Description:
Novel protein similar to vertebrate sorbin and SH3 domain containing 2 (SORBS2) [Source:UniProtKB/Tr
Human Orthologue:
SORBS2
Human Description:
sorbin and SH3 domain containing 2 [Source:HGNC Symbol;Acc:24098]
Mouse Orthologue:
Sorbs2
Mouse Description:
sorbin and SH3 domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1924574]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa1724 Nonsense Available for shipment Available now
sa32640 Nonsense Mutation detected in F1 DNA Not yet available
sa39586 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa39585 Essential Splice Site, Missense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa1724
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041215 None None 1236 None 26
ENSDART00000138475 Nonsense 357 1258 10 21
Genomic Location (Zv9):
Chromosome 1 (position 16512406)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 17077574
GRCz11 1 17770511
KASP Assay ID:
554-1670.1 (used for ordering genotyping assays)
KASP Sequence:
CGTTTGTTCTGGTGGCGGGACGTTCAGCCTCCTAAAAAGAGGTTGGATTA[T/A]AATCCTGACTACTCCACACATACTGTGGCACAGGTAAATCTGTCTTCCTG
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa32640
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041215 Nonsense 622 1236 14 26
ENSDART00000138475 Nonsense 654 1258 13 21
Genomic Location (Zv9):
Chromosome 1 (position 16504043)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 17069211
GRCz11 1 17762148
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAGGTCATGAGGTGCCACGGCAAATGGTTCCAAACCGTATATCTGCATA[T/G]GAACAGCTTATCCAAAAATCAAAGTCTATGCCAGATCTTGGCGATGAAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1541
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041215 Nonsense 885 1236 14 26
ENSDART00000138475 Nonsense 917 1258 13 21
Genomic Location (Zv9):
Chromosome 1 (position 16503256)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 17068424
GRCz11 1 17761361
KASP Assay ID:
554-1484.1 (used for ordering genotyping assays)
KASP Sequence:
TAGATGCCGCTTTACAGGACATTTATGACCACATAAGGGCGGAAAAGGGA[C/T]AAGAACCAGCAAGGATGCCAGATGATAGCATATTGCGCCGGTTGTTGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39586
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041215 Essential Splice Site 1018 1236 17 26
ENSDART00000138475 Essential Splice Site 1052 1258 15 21
Genomic Location (Zv9):
Chromosome 1 (position 16501793)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 17066961
GRCz11 1 17759898
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGAAACAGTCTGCCAGAGCAATTTATGATTTTAAAGCTCAGTCTGCCAA[G/T]TGAGTATACAGAAATGTGAAAGAAGCTCACTGGTGCATGCCAATAACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39585
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site, Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041215 Essential Splice Site 1176 1236 None 26
ENSDART00000138475 Missense 1197 1258 19 21
Genomic Location (Zv9):
Chromosome 1 (position 16491614)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 17056782
GRCz11 1 17749719
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTATATTATACAGTTTTTTTCTTTCTTTCAGAAAATGATGCAGGATTCTC[A/T]GCATGCAGGTGGTGACCCGTAAGTATTTTTTAGCACTTTAATTTTGACTA
Associated Phenotype:
Not determined