Busch Lab

ZMP

wu:fi40b08

Ensembl ID:
ENSDARG00000003025
ZFIN ID:
ZDB-GENE-030131-6243
Description:
Wu:fi40b08 protein [Source:UniProtKB/TrEMBL;Acc:Q7SXV7]
Human Orthologue:
ANGPTL1
Human Description:
angiopoietin-like 1 [Source:HGNC Symbol;Acc:489]
Mouse Orthologue:
Angptl1
Mouse Description:
angiopoietin-like 1 Gene [Source:MGI Symbol;Acc:MGI:1919963]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa14255 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25728
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017007 Nonsense 404 486 6 7
ENSDART00000121888 Nonsense 403 485 4 6
Genomic Location (Zv9):
Chromosome 2 (position 109422)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150706.1 1215
GRCz11 2 98467
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAGTCGTACCGCCTGCGTCTGGGACTCTATCAGGGAAACGCTGGAGATT[C/A]ATTAACCAGCCACAATGGCAGACAGTTCACCACGCTGGACAGGGACCACG
Long Flanking Sequence:
GACGAGTTCAGATGTTGACTAGTGAGTAGATGAGTTCTGATGTTGACTAGTGAGTAGATGAGTTCTGATGTTGACTAGTGAGTAGATGAGTTCTGATGTTGACTAGTGAGTAGACGAGTTCTGATGTTGACCAGTGAGTAGATGAGTTCTGATGTTGACTAGTGAGTAGATGAGTTCAGATGTTGACTAGTGAGTAGATGAGTTCTGATGTTGACTAGTGAGTAGACAAGTTCTGATGTTGACTAGTCAGCTAGCTACTCATCTAGTGTTTCCTCTGCTCGTCGTCCTGCAGCTGGGCTTTGGGGATGTGGACGGTGAGCACTGGCTGGGTCTGGACACCATCTATAGTCTGGGCAGACAGGAGGAGTATAAGCTGCTGGTGGAGATGGAGGACTGGATGGAGAAGAAGGTCTACGCGGCGTACAGCAGCTTCCACCTGGAGCCCGAGAGCCAGTCGTACCGCCTGCGTCTGGGACTCTATCAGGGAAACGCTGGAGATT[C/A]ATTAACCAGCCACAATGGCAGACAGTTCACCACGCTGGACAGGGACCACGACGCCTTCTCAGGTTTATACACACACCTGAACACACACACATACGACTCTCTCCTTTACACTGTGTGTGTGATGCTGACGCTCTGATGGTGTTTCAGGGAACTGTGCTCATTTCCAGAAGGGCGGCTGGTGGTACAACGCCTGCGGTCAGACCAATCTGAACGGCGTGTGGTACTCAGGCGGAGTGTATCGCAGCCGCTTTCAGGACGGCATATTCTGGGCCGATTACGGCGGAGGGTTTTACTCCATGAAGTCTGTGCGTATGATGATCCGACCCATCGACTGATCAGCTGTGATGAAAACTGGAACTCACCACAAAAACTACATTACCCATGATGCTGTTGAGGAAATCCCACCAATCAGAGGAATCTTTAGCTCCGCCCTCTCCAATCAAGCACTGCAGACACACAGCACACAGTGTTGATGGTTGAATGGCTGTAGATCTCTTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14255
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017007 Essential Splice Site 425 486 6 7
ENSDART00000121888 Essential Splice Site 424 485 4 6
Genomic Location (Zv9):
Chromosome 2 (position 109358)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150706.1 1151
GRCz11 2 98403
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAYGGCAGACAGTTCACCACGCTGGACMGGGACCACGACGCCTTCTCAGG[T/C]TTATACACACACNNNNACACACACACATAMNNNNNNNNNNNNGACTCTCTCCTTTACACTGT
Long Flanking Sequence:
CTGATGTTGACTAGTGAGTAGATGAGTTCTGATGTTGACTAGTGAGTAGACGAGTTCTGATGTTGACCAGTGAGTAGATGAGTTCTGATGTTGACTAGTGAGTAGATGAGTTCAGATGTTGACTAGTGAGTAGATGAGTTCTGATGTTGACTAGTGAGTAGACAAGTTCTGATGTTGACTAGTCAGCTAGCTACTCATCTAGTGTTTCCTCTGCTCGTCGTCCTGCAGCTGGGCTTTGGGGATGTGGACGGTGAGCACTGGCTGGGTCTGGACACCATCTATAGTCTGGGCAGACAGGAGGAGTATAAGCTGCTGGTGGAGATGGAGGACTGGATGGAGAAGAAGGTCTACGCGGCGTACAGCAGCTTCCACCTGGAGCCCGAGAGCCAGTCGTACCGCCTGCGTCTGGGACTCTATCAGGGAAACGCTGGAGATTCATTAACCAGCCACAATGGCAGACAGTTCACCACGCTGGACAGGGACCACGACGCCTTCTCAGG[T/C]TTATACACACACCTGAACACACACACATACGACTCTCTCCTTTACACTGTGTGTGTGATGCTGACGCTCTGATGGTGTTTCAGGGAACTGTGCTCATTTCCAGAAGGGCGGCTGGTGGTACAACGCCTGCGGTCAGACCAATCTGAACGGCGTGTGGTACTCAGGCGGAGTGTATCGCAGCCGCTTTCAGGACGGCATATTCTGGGCCGATTACGGCGGAGGGTTTTACTCCATGAAGTCTGTGCGTATGATGATCCGACCCATCGACTGATCAGCTGTGATGAAAACTGGAACTCACCACAAAAACTACATTACCCATGATGCTGTTGAGGAAATCCCACCAATCAGAGGAATCTTTAGCTCCGCCCTCTCCAATCAAGCACTGCAGACACACAGCACACAGTGTTGATGGTTGAATGGCTGTAGATCTCTTTCCCTCACTGAACCCATGTCATCACATGCTGTATGCCGGTGCCGGATCACTGCCTGCTGGGCCAGCT
Associated Phenotype:
Not determined