Busch Lab

ZMP

hdac8

Ensembl ID:
ENSDARG00000003021
ZFIN ID:
ZDB-GENE-040426-2772
Description:
Histone deacetylase 8 [Source:UniProtKB/Swiss-Prot;Acc:Q7SXM0]
Human Orthologue:
PHKA1
Human Description:
phosphorylase kinase, alpha 1 (muscle) [Source:HGNC Symbol;Acc:8925]
Mouse Orthologue:
Phka1
Mouse Description:
phosphorylase kinase alpha 1 Gene [Source:MGI Symbol;Acc:MGI:97576]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa44675 Nonsense Mutation detected in F1 DNA Not yet available
sa38642 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa14948 Nonsense Available for shipment Available now
sa31597 Nonsense Available for shipment Available now
sa10754 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44675
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009184 None None 378 None 11
ENSDART00000083190 Nonsense 908 1376 25 39
ENSDART00000108984 None None 378 None 12
ENSDART00000136047 None None 279 None 8

The following transcripts of ENSDARG00000003021 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 53176529)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 51446279
GRCz11 7 51721349
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAGGAGATCATAGTGTACCTAGCGATGATCATCAGAACGCAGCGCAGTT[T/A]GTTCAGTGAGATGTTTCGGCTGAGGATCGGCCTCATCATTCAGGTTATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38642
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009184 None None 378 None 11
ENSDART00000083190 Essential Splice Site 970 1376 26 39
ENSDART00000108984 None None 378 None 12
ENSDART00000136047 None None 279 None 8

The following transcripts of ENSDARG00000003021 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 53176073)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 51445823
GRCz11 7 51720893
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTCTTCACCACATTCTGAGCGGAAAAGAATTCGGTGTTCAGAGAAGTGG[T/C]GAGTGACTTCATGAGAATTACTGGGCTTTAAGGGCAGTGTTTCTCAATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14948
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009184 Nonsense 155 378 5 11
ENSDART00000083190 Nonsense 1153 1376 33 39
ENSDART00000108984 Nonsense 155 378 5 12
ENSDART00000136047 Nonsense 56 279 2 8

The following transcripts of ENSDARG00000003021 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 53160613)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 51430363
GRCz11 7 51705433
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAATTGAATGTGTGTTGTTATATAAGGGACGAGGCATCTGGCTTCTGTTA[T/A]GTGAATGACGCGGTTCTTGGAATCCTCAAACTTCGGGAGAAGTATGACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31597
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009184 Nonsense 297 378 8 11
ENSDART00000083190 Nonsense 1295 1376 36 39
ENSDART00000108984 Nonsense 297 378 8 12
ENSDART00000136047 Nonsense 198 279 5 8

The following transcripts of ENSDARG00000003021 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 53153442)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 51423192
GRCz11 7 51698262
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACTTCTGTTGGAGTCGCAAAGTGTCTAACCTATATACTTGGCTGGGAGT[T/A]ACCTACTTTGCTACTAGGAGGAGGTGCGTGTTATTGCTTTTGTTAAATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10754
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009184 Nonsense 307 378 9 11
ENSDART00000083190 Nonsense 1305 1376 37 39
ENSDART00000108984 Nonsense 307 378 9 12
ENSDART00000136047 Nonsense 208 279 6 8

The following transcripts of ENSDARG00000003021 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 53148730)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 51418480
GRCz11 7 51693550
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCACTCACTGTATATACAAATCTGCCTCTCTCTCCTTTCTCAGGCGGCTA[T/A]AACCTTGCCAATACTGCCCGCTGCTGGACCTATCTAACGGGGACCGTCCT
Associated Phenotype:
Not determined