Busch Lab

ZMP

ss18

Ensembl ID:
ENSDARG00000002970
ZFIN ID:
ZDB-GENE-030131-4867
Description:
protein SSXT [Source:RefSeq peptide;Acc:NP_956038]
Human Orthologue:
SS18
Human Description:
synovial sarcoma translocation, chromosome 18 [Source:HGNC Symbol;Acc:11340]
Mouse Orthologue:
Ss18
Mouse Description:
synovial sarcoma translocation, Chromosome 18 Gene [Source:MGI Symbol;Acc:MGI:107708]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa39745 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39745
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011919 Nonsense 306 368 8 10
Genomic Location (Zv9):
Chromosome 2 (position 2371703)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 2239355
GRCz11 2 1351773
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGGCCCGCCTCAGCAGCAGGGTTACCCACCGCAGCAGCAGTACAGCGGG[C/T]AGCAGGGATACCCGGGACAGCAGCAGGGCTACGGTACGAACACACCGACG
Long Flanking Sequence:
TGTTTGAAAACTAGCCTAGAATGCTGTTAAAAACTAGCTTTGAGCGCCGTCTGCTGTTAAAAACTAGCCTAGAGTGACATCTGCTGTTTAAAAACTAGTCTAGAGCGCTGTCTGCTGTTTAAAAACTAGTCTAGAGCGCTATCTGCTGTTTAAAAAGTAGTCTAGAGCGCCATCTAATGTTTGAAAACGAGCCCAGAATGCTGTTAAAAGCTAGCCTAGCCATTTACTGTTTATAAACTAAGCTCTGAATTGATTCAAGAGTGAAAAGTGGTGCATTTTGAAAATCTCAGAAATGATTTCTTAAGCAAATTTGCCACAGCTCCATATTCCTCTATTTCCACCAGCAATAGCTGCTTCGCTCGGCCCCGTAACTAGTGTAGTTTGCTGAAGTGTGTGGTAATCTTCCTGTAGGAAACACACAGTATGGTCAGCAGCAGGAGGCATATCAGCAGGGCCCGCCTCAGCAGCAGGGTTACCCACCGCAGCAGCAGTACAGCGGG[C/T]AGCAGGGATACCCGGGACAGCAGCAGGGCTACGGTACGAACACACCGACGGATCCAGCACTGTGTCCATTCACGCAGATGCTTCATACAAACATACTCCTGCTATTCAAAGTGTAGTTTAGATGAAGAGATGACATGATCAGAATAAAGTAGATCAGGGATGGGCAACAGCGGTCACTGTCCTGTAAAGTAAAAGGATAGTTCACTCAAAAAGTACAGTTCTGTCATTTCCTCATCCTTTACTTGTTTCAAACCTTTGCATTTCTTTCTTTGATCACAAAAGAACATATTTAGAAAATAAAATAAAACCTGTAACTATTGACTTCCATAATATTTGTGATTCCTACTGTGGAAGTCAATGGGCTTCAGCTTTTTTTAAATTAACTTCTCTTGTGCTCAACAACACAACATCTGGAACCACTCGAGGGTGAGTAAACAGTGAGTAAATGCTCAATTTTGGGTGAACTATCACTTTAACTCCAACCCTAATCAAACAAAGCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8072
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011919 Nonsense 331 368 9 10
Genomic Location (Zv9):
Chromosome 2 (position 2369535)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 2237187
GRCz11 2 1349605
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCCTACAGGTCCMTCAMAAGGCGCTCCAAGTCAGTACCCAAACTACCCG[C/T]AGAGTCAAGGGCAGCAGTATTCAGCCTACAGAGCCCCGCAACCCGGACCA
Long Flanking Sequence:
CCAGTAGATCAGCTTTGCAATTATAAACACTGTGAAGGGAATTTTATTGGCTTAAAACCTCTTCATGTTTCCACTTGATTGCACTGGATAGCAAGTACATCTGCACTTAAAGTGAGTTCACGCAAAAAATGAAGATTCTGTCATTAGTTACTCTCACTTGTTCAGAATCTTTTCTTTGTTTTGTTGAACACGAAAGAAGATATTTTGAAGAATGCTGAAAACCCGTAACTATTGACTTCCATAGTATCTGCTTTTCCAACTCTAAAGGTTACTGGTTTTCCGCTTCCATCGTAATATTTTCTTTTGTGCTCAATAGAAGAAAATCGTAGAAGTTTGAAACAACTTGGTGAGTAAATTTTTGCGTGAACTACCCCTTTAAGTTGTACTTTTGTACTTGTATGTGAAGAGGCAGAGGCGAATATGATCAAGCATGCAATCAAACGCTCTGCTTTCCTACAGGTCCATCACAAGGCGCTCCAAGTCAGTACCCAAACTACCCG[C/T]AGAGTCAAGGGCAGCAGTATTCAGCCTACAGAGCCCCGCAACCCGGACCACCACAGGGACAACCACAGCGCCCGTATGCTTTTGACCAGGTGAGACACTCAAACAACAGTACTCCTGAAGAGATCTATAGAAATCTGGCTTCATAAAAATGTAAATTGTGGCTTCCCATGATGTATGAAAGTGCTTGAATGTGAATTAACGCACTTAATAACAAACATATCTCCTTAAAAGTGCTTGAATTAACGTTTATAGTGTATATTCAGCAATTGAGTGTTGTGTGGAACTAACCAAACACTGTTTGCAGTGTATTAAGGTCATAAAAACATACATTTTTGGGTGAGATATCCCTTTAAGTAACATTAATGTAGTGTTTACGTGATTTAAAAGAGTAATTCTGGCTGTGAGCTCTCTCATACTTAAAAGTGCTCTGTGTTTTTCTCCACAGGGTCAGTATGGAAACTACCAGCAGTAAACGATGAGGATTTTGACGATCTGCCCCA
Associated Phenotype:
Not determined