Busch Lab

ZMP

ITGAM

Ensembl ID:
ENSDARG00000002956
Description:
integrin, alpha M (complement component 3 receptor 3 subunit) [Source:HGNC Symbol;Acc:6149]
Human Orthologues:
ITGAD, ITGAM, ITGAX
Human Descriptions:
integrin, alpha D [Source:HGNC Symbol;Acc:6146]
integrin, alpha M (complement component 3 receptor 3 subunit) [Source:HGNC Symbol;Acc:6149]
integrin, alpha X (complement component 3 receptor 4 subunit) [Source:HGNC Symbol;Acc:6152]
Mouse Orthologues:
Itgad, Itgam, Itgax
Mouse Descriptions:
integrin alpha M Gene [Source:MGI Symbol;Acc:MGI:96607]
integrin alpha X Gene [Source:MGI Symbol;Acc:MGI:96609]
integrin, alpha D Gene [Source:MGI Symbol;Acc:MGI:3578624]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa6230 Nonsense Mutation detected in F1 DNA Not yet available
sa7367 Missense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4447
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025912 Nonsense 157 1145 6 31
Genomic Location (Zv9):
Chromosome 12 (position 4802743)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4085465
GRCz11 12 4122230
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAAATGTGATGCAAATCTTCTTTTCTCCAACCTCAGAATGCCCCAAATCA[C/T]AAATTGATATTGCTTTTTTATTGGATGGATCTGGAAGTGTAGATCCTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6230
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025912 Nonsense 228 1145 7 31
Genomic Location (Zv9):
Chromosome 12 (position 4803051)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4085773
GRCz11 12 4122538
KASP Assay ID:
554-5241.1 (used for ordering genotyping assays)
KASP Sequence:
TTCAACAAGTCAAAAACCCTGCCTGGTGGCAAAGAGCAGTGAATGGGATA[C/T]AACAAACACATGGATGGACTTTCACTGCAACAGCTATAAGACTGCTTGTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4448
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025912 Nonsense 392 1145 11 31
Genomic Location (Zv9):
Chromosome 12 (position 4809069)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4091791
GRCz11 12 4128556
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGGAGCTTTTCAGTGGAAAGGTGGATATCAGCTCTTCAAATTAAACGAC[C/T]AGACAAGTGTCTTTCAAGCTGGAAGTGAGCATAACAGTTATTTAGGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7367
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025912 Missense 578 1145 16 31
Genomic Location (Zv9):
Chromosome 12 (position 4813271)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4095993
GRCz11 12 4132758
KASP Assay ID:
554-4367.1 (used for ordering genotyping assays)
KASP Sequence:
CCTTCACTGTGTCTAATGGCAGAGGATTGCTGGATCATCTGTGCAGTCAG[G/A]ATTGCAGTACTTTGGTGTTTCMTTRAGTCAATCYTCTCCAGACCAGACTG
Associated Phenotype:
Not determined