Busch Lab

ZMP

sec31b

Ensembl ID:
ENSDARG00000002916
ZFIN ID:
ZDB-GENE-060418-2
Human Orthologue:
SEC31B
Human Description:
SEC31 homolog B (S. cerevisiae) [Source:HGNC Symbol;Acc:23197]
Mouse Orthologue:
Sec31b
Mouse Description:
Sec31 homolog B (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2685187]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa42099 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa42098 Nonsense Mutation detected in F1 DNA Not yet available
sa873 Essential Splice Site Available for shipment Available now
sa10739 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42099
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014190 Essential Splice Site 27 1171 1 27
Genomic Location (Zv9):
Chromosome 12 (position 49760449)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 48483822
GRCz11 12 48467144
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACACAGGCGTGGAGTCCTGCCAGACAACACCCGGCCTACCTGGCCTTAGG[T/C]AAGAGTGTGTGTGTGTGTGTGTTGTATGATTGTATGTTTGTGTAACACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42098
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014190 Nonsense 133 1171 3 27
Genomic Location (Zv9):
Chromosome 12 (position 49752577)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 48475950
GRCz11 12 48459272
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTCTAATAAACACACGGGACCTGTTCGAGCCCTCGACTTCAACCGCTTT[C/T]AGGTAAGCCATATCAACCCATATGATTAGCTTCAGTATATCATTCATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa873
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014190 Essential Splice Site 260 1171 6 27
Genomic Location (Zv9):
Chromosome 12 (position 49747188)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 48470561
GRCz11 12 48453883
KASP Assay ID:
554-0775.1 (used for ordering genotyping assays)
KASP Sequence:
GATCTTCGGTTCGCAACATCACCTCTAAAAGTGCTGGAGAACCACACCAG[G/A]TAGAGAAACCCGCATTTCTACTCAACATTAATAATATCACATCATTATTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19047
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014190 Nonsense 490 1171 11 27
Genomic Location (Zv9):
Chromosome 12 (position 49741585)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 48464958
GRCz11 12 48448280
KASP Assay ID:
2260-5803.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTTTTCTGTCACAGGTGAATTTTGAGGATGAAGCGCGTGTGAAGTTTT[T/A]GAGGCTTCTGGGATTCAGTAAAGACGAGCTGCAGAGAAAGGTATCGCAGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2671
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014190 Nonsense 508 1171 12 27
Genomic Location (Zv9):
Chromosome 12 (position 49739158)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 48462531
GRCz11 12 48445853
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTGAGTTTGTATTGAGCTGTTGTGTGTTTTCTGCAGATCTCCGCTTGTT[T/A]GGGAAGGAAACTTCAACCCAACGGTTTAGATGTGAATGACCTTGCAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10739
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014190 Nonsense 578 1171 14 27
Genomic Location (Zv9):
Chromosome 12 (position 49736732)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 48460105
GRCz11 12 48443427
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTATTGTATGTCTATTTTGTTACTAYCTGTGTGTGCAGATACAGACGGTT[T/A]GATCAGTCAGGCGCTGTTAGTGGGAAACTTCGAGGGCGCTGTGGATCTGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28028
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014190 Essential Splice Site 633 1171 14 27
Genomic Location (Zv9):
Chromosome 12 (position 49736564)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 48459937
GRCz11 12 48443259
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAAACCCAGCAGAGATACCTGCAGCGACAGACCAACAGCATCTCCATGG[T/A]GAGCATGCATCACTGATGACAGCACATTTCAGCATCAAATCATTTTCATT
Associated Phenotype:
Not determined