Busch Lab

ZMP

tjp3

Ensembl ID:
ENSDARG00000002909
ZFIN ID:
ZDB-GENE-030828-10
Description:
tight junction protein 3 [Source:RefSeq peptide;Acc:NP_958902]
Human Orthologue:
TJP3
Human Description:
tight junction protein 3 (zona occludens 3) [Source:HGNC Symbol;Acc:11829]
Mouse Orthologue:
Tjp3
Mouse Description:
tight junction protein 3 Gene [Source:MGI Symbol;Acc:MGI:1351650]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa17625 Essential Splice Site Available for shipment Available now
sa15182 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17625
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012336 None None 506 None 10
ENSDART00000128397 Essential Splice Site 216 1255 5 30
ENSDART00000137995 None None 825 None 20
ENSDART00000139911 Essential Splice Site 244 294 6 7
ENSDART00000147070 Essential Splice Site 216 480 6 14
Genomic Location (Zv9):
Chromosome 22 (position 17898788)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17649723
GRCz11 22 17674701
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTGGCTGCCAAAGAAGGCTCGCTTCAGGAGGGAGATCTGGTTTTAAAGG[T/G]GAACAGCAGATTCTCAAATCAAATCACTTTTATTATCACATMATCAGCAG
Long Flanking Sequence:
AATGCTCATGATAACACATAGGTGAGTGTACTGAGTGAATGTTTTGCTGGTGTTGTAGACTGTGAAGAGGCCGCGCACGATCCAGATTCCTGCCAGCAGCAGACCCACTCGCTCAGCCTCTCAGTCCAACATTTTAGACGATAAAGGACCTCAGTATAAGGGTCAGCGGGGCCCTGACACCACACGCACCCGCCGGGCCCGAAGCGTCACTCCTGACCGCAATGGCCACGATCTGCCCATCACATCCGGATACAAGCGACTGCCCAATCAGGACGTCCAGAACAAACCCATCAAGACCACTCTGATCAAGAAGAAGCCCACCGACGGTCAGTGTCTCCTGAATAATGGCTTGTGGTTTTTTTGGCAGGTTTTTAACCCCATTTCTCTGTCTGTAGAGTATGGAATGAAGCTGGGGAGCCAGATCTTCATCAAGCACATGACTCCCACCGGTCTGGCTGCCAAAGAAGGCTCGCTTCAGGAGGGAGATCTGGTTTTAAAGG[T/G]GAACAGCAGATTCTCAAATCAAATCACTTTTATTATCACATCATCAGCAGCACTTGTACTATGATGGGTGAAAAGCTTAGGTGTGCTCCAGACAGTGCAAAATACAACAACATACTTCAAAAACAAACAATATACTGTTAGCAGTGTTGACAAGAAAACACATGTAGGCACAGATGGACAAGAAGGACATCTTCACTGTTCTTTATCAAACGATTTTTACTATCATTATTATTATTAATATTATTTGTTTTGCTTTTTTTGTTTGTTGGCTATCGGTCAGCTTTTTTGAAGGTTTCAACATCCGTAAATTCTGATGTTTTCTTTCTTGAGAGATGCCAACTCACAATTCTGAGATAGACGTCAAAGTTAAGAGATTATAAGAGTGAGAAATATATAAAATCAGATCAAGCAAAAAAAGAGATGATGAAAATTTGCAATTGAAAGATATGAACAGAAAAAAATGACTGCATGTCTACAAATGAAGACCATTTTTCTGAAGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4998
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012336 None None 506 None 10
ENSDART00000128397 Nonsense 643 1255 20 30
ENSDART00000137995 Nonsense 213 825 10 20
ENSDART00000139911 None None 294 None 7
ENSDART00000147070 None None 480 None 14
Genomic Location (Zv9):
Chromosome 22 (position 17887795)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17638730
GRCz11 22 17663708
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGCTCCGATCAGAACCATATCAGCTTTGTGAAGGAAGGCAGTGTCGGCT[T/A]GAGACTTGTGGGAGGAAATGATGTTGGCATCTTTGTCGGTGGTGTCCAGC
Long Flanking Sequence:
CTTGTGAGTATCTGCAATCCAAAAGCACACCCACAATACATTGCAACTTATAGAGTGACTATCGAGGACCTAATTGTAACTGTTTTGTTTTAGCTAAAGCTGTAGAAGAACCACTTTATGTGCTTCCACCAGACGCAGTGCCAACACCAAACCTGGGGTGAGAAGTTGTAAATATCACTTTTATTAAAAAACAAGACTGATTCAAATTTGTTTTATTTAATTATATTAAGAAAATTATATTTACACTTTATTTAAATTAAACATAATCAATTCAATTATTTTTTTTATTTTTTTTTGTGTGTTTTTTTATTAATTATAAATATATTGAAATAAATATAAAGAATTTGCACAACTTACAATCTATAATTTATACAATTTATGTATACATATTATGTATATCTACAAAAACTATATTTCATGTATCATATCATTTAAATTCTATCTCAGGTACAGCTCCGATCAGAACCATATCAGCTTTGTGAAGGAAGGCAGTGTCGGCT[T/A]GAGACTTGTGGGAGGAAATGATGTTGGCATCTTTGTCGGTGGTGTCCAGCCTAACAGTCCAGCCCAAAAGCAAGGCATAACAGAGGGTGATCAGATTCTGGAGGTAGGACTAAACGATCAACCACATCTCATACAAAACCAAACTTTTCTGTGTTCTCCATTCTTTAAGACACTCTGCATTTGCAGGTAAATGGCATGGATTTTAACCACTTTACCAGAGAAGAAGCAGCAATGTATCTTATGAACATACGTGGTGGAGAGCGTATCGATATGCGGACTCAGAACAAAGCAGACAGTAAGTGCTTTTATATCCTTGTTTTAGGAAATAAAAACGGCTACAAATGTATTTTCAAAGCTGATTTTTCCTCTCATCATAGTCTACAAGAAGATTCTGAAGTCCAACCTTGGAGATTCTTTCTACATCCGCACACACTATGATCATGTGGCAGACAGCAGCGTCGGCTTAAGCTTTACCAGAGGCGAGGTGTTCAGAGTGGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15182
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012336 Nonsense 492 506 10 10
ENSDART00000128397 Nonsense 1241 1255 30 30
ENSDART00000137995 Nonsense 811 825 20 20
ENSDART00000139911 None None 294 None 7
ENSDART00000147070 None None 480 None 14
Genomic Location (Zv9):
Chromosome 22 (position 17882054)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17632989
GRCz11 22 17657967
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGAGGAAGCGACAGTGACAGCGACGAAAACGACAGAGATGAAGACGAATA[T/G]GACGAAGCAGAAGACATTGAATGGGGAYCTGCTACAGAGCTGTAAWATAC
Long Flanking Sequence:
TCACGCTGAATCAAAGAATTTAAAAACAAGTTTATTATGTAGCGCTATGGGGTGCTTTTTTGAGTTTCTTCTTTGTGGGTGTTTTGAGTTTCTGCATTAGAGTGCCCTCTGGCCTTCGGAGGAGATTTACTACTGAACACAGAACCGTGCTTTTTGGACAAGATGTGCATGACAATTGCAGATTTGCTTAATCGTGTTTGTGATTTTTATATCAGTTGATTGCCCAGCCCAAGGAGCTGTTTATCACTGCATATATTTTATTGTTTCAGGCTCGCATGGCAGAACAGATTGAACCAGAAAGGAAACCTTCGCCTTCTTTTATAGTGTAAGTATTTTTTTGGCATGTTCTGCCAACTTATATATTTATTTTTTCAGTTTTAAATGTATTAATAAATGTTTTTATGTAGACTCGCACATCATGAAGCCATGCAAATGCGGAGAACGCAAATCCGAGGAAGCGACAGTGACAGCGACGAAAACGACAGAGATGAAGACGAATA[T/G]GACGAAGCAGAAGACATTGAATGGGGACCTGCTACAGAGCTGTAATATACATGGATTACACTACATTAAGACCCAAAACGGGGACATGGACCTTTAATCTGGACTTGTACAGTACATTCACACAACCAAACGTTTTTGTATTGACTTTCGTAATTTGGAATCGATTTGTGACCTGAATCGCTTGCTTTTTGTGGGTCACATTGTTTTAATAGATGTTCTGAGGTCAAACTCAGGATTATTTCAAAAAGAAATATTTCCTGTTGTTTTTTTAAAAAAAGTATGATTTGGGTACGTTTTACCCTCTTCAGCAACTAACTAAATATAATTTTTATTTGTATATTGAAATAAATGGAACAGAAAAATTAAGCTCTCGCTCTGATTAATGTTGGGAAGTGCTTTGGATTTTATTTTGACTAAATATTTTCAACAATTTATTCAATTTAAACGACACTAAATATGCTGTCAAATGACATTTCAACATTGTATTTTTTATATGTGGG
Associated Phenotype:
Not determined