Busch Lab

ZMP

DGKA (2 of 2)

Ensembl ID:
ENSDARG00000002898
Description:
diacylglycerol kinase, alpha 80kDa [Source:HGNC Symbol;Acc:2849]
Human Orthologue:
DGKA
Human Description:
diacylglycerol kinase, alpha 80kDa [Source:HGNC Symbol;Acc:2849]
Mouse Orthologue:
Dgka
Mouse Description:
diacylglycerol kinase, alpha Gene [Source:MGI Symbol;Acc:MGI:102952]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa38819 Nonsense Mutation detected in F1 DNA Not yet available
sa16107 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa38819
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009863 Nonsense 482 785 20 29
Genomic Location (Zv9):
Chromosome 11 (position 2470658)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 2422990
GRCz11 11 2492344
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGACGTCTGCGTGTTTCAGGCTGCAGTTCTTCCAGAATCTTCAGGCGTTC[A/T]GAGTGCTGGTGTGTGGAGGAGACGGCACTGTGGGCTGGGTTTTAGATGCT
Long Flanking Sequence:
ATTATAATTTTTATATCATGTAACTTAATATATTAAGACTATTTTTGATTAGTATAGTATTTTGATAAAGTATAACCTAATTTGGACAGCTCTAAAGGTGATTTTGTCACCTTCAGGTTTCAGATTTTCAAATAGTTGCATAATAGTTATCATAACAAATCAATGGAAAGATGAATTATTCAACGTTCATAATCTATTAATCTCCATTACATAACTGGTTTTGTGGTCCAGGCTCACATATGAAAACCAGTTTTAGATTTACATAATAAGCACAATCAATGCTAAACGATCACTCTGTCATTTATTTAGGGTGTTGAGAAAGTTTCAGTACCTCCTGAACCCACGACAGGTTTACAATCTGGACAACGGAGGACCAAATCCAGGGTACGTTTATTAACAACACAAGTAAACACTGACACACATTTGCCAAATGAACTCACATGTGTCTGCGGACGTCTGCGTGTTTCAGGCTGCAGTTCTTCCAGAATCTTCAGGCGTTC[A/T]GAGTGCTGGTGTGTGGAGGAGACGGCACTGTGGGCTGGGTTTTAGATGCTATTGGTGAGAAACTTGCAGTTTGCAACTGAAATAGTTATATGGACGGCATCACTGACCAACTAAAAGCTACTCTAAAGTCAATGGTGCAGATTTTTACTGATGTTTGAAGAGCGTGTTTGTGTTATGCTCCTATGTGGGTACAAAACACGCATACTCATTGCTTATTAGCAGGGCCAGACGGAATCTGCAGACGTTTTTTGCTATTTCTGCTGAGATTTTTGGTAAAAATCTGTGGATTTCTGCGAAATTATTTTGGGAGTATCCAGCGGAGTATCATAACTAAAACCTTAATATATTCAATAAAAAGGCAATAAATTACTGAATAAAAGCTGAATAAATTTAGATTTACACATTTACTCAAGTAAATAAACAGAATTAATAATGGTTAAAAATCTGCGAAAGATCTGCAGAATTCTGCGCGCACAGATTCTGTGTGGGCCTACTTATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16107
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009863 Essential Splice Site 499 785 20 29
Genomic Location (Zv9):
Chromosome 11 (position 2470603)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 2422935
GRCz11 11 2492289
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTGGTGTGTGGAGGAGACGGCACTGTGGGCTGGGTTTTAGATGCTATTG[G/A]TGAGAAACTTGCAGTTTGCAACTGAAATAGTKATATGGACGGCATCACTG
Long Flanking Sequence:
AGTATTTTGATAAAGTATAACCTAATTTGGACAGCTCTAAAGGTGATTTTGTCACCTTCAGGTTTCAGATTTTCAAATAGTTGCATAATAGTTATCATAACAAATCAATGGAAAGATGAATTATTCAACGTTCATAATCTATTAATCTCCATTACATAACTGGTTTTGTGGTCCAGGCTCACATATGAAAACCAGTTTTAGATTTACATAATAAGCACAATCAATGCTAAACGATCACTCTGTCATTTATTTAGGGTGTTGAGAAAGTTTCAGTACCTCCTGAACCCACGACAGGTTTACAATCTGGACAACGGAGGACCAAATCCAGGGTACGTTTATTAACAACACAAGTAAACACTGACACACATTTGCCAAATGAACTCACATGTGTCTGCGGACGTCTGCGTGTTTCAGGCTGCAGTTCTTCCAGAATCTTCAGGCGTTCAGAGTGCTGGTGTGTGGAGGAGACGGCACTGTGGGCTGGGTTTTAGATGCTATTG[G/A]TGAGAAACTTGCAGTTTGCAACTGAAATAGTTATATGGACGGCATCACTGACCAACTAAAAGCTACTCTAAAGTCAATGGTGCAGATTTTTACTGATGTTTGAAGAGCGTGTTTGTGTTATGCTCCTATGTGGGTACAAAACACGCATACTCATTGCTTATTAGCAGGGCCAGACGGAATCTGCAGACGTTTTTTGCTATTTCTGCTGAGATTTTTGGTAAAAATCTGTGGATTTCTGCGAAATTATTTTGGGAGTATCCAGCGGAGTATCATAACTAAAACCTTAATATATTCAATAAAAAGGCAATAAATTACTGAATAAAAGCTGAATAAATTTAGATTTACACATTTACTCAAGTAAATAAACAGAATTAATAATGGTTAAAAATCTGCGAAAGATCTGCAGAATTCTGCGCGCACAGATTCTGTGTGGGCCTACTTATTACACACACAGGGATGCACAGCTGCACACGGATATCTTTAAATATTCGTTCATTCTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27710
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009863 Nonsense 624 785 24 29
Genomic Location (Zv9):
Chromosome 11 (position 2465484)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 2314439
GRCz11 11 2487176
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAATAAGCTGTGGTATTTTCAGCTCGCAACTTCAGAGACCATTTCAGCTT[C/A]GTGCAGGAACCTGAAGGACTGTCTCAGCATTGAGGTAAACACAAACAGAA
Long Flanking Sequence:
GTGTTAACCATTGAGTCACCCTGCCGCCTACATTATATATATATATTTTTTTTTTTTATTATATTTATTTTCAAATTCTGAAGTAAATTATCCATTGTTGCTCTCATTAAATTCATGAAAAATAATATTCAGAAATAATATTCAAAGCACAACCGCGCTCTTTCTGTTCATTATAGACTACAGCTTTTTAGTCAGTAAAGTTCAGGGGAACAATCAGGGAATGTCTAAGAGAGTGAGCTCTGTGTTATGGTTGTTTCTCCAACAGGACGCTTCGATAGCGCACCAGTTTCATGTGATGAGAGAGAAACATCCTCAAAAGTTCAACAGCAGGTCAGGATCTCAGATGTACTTGTTTAACTAAACATTTTGTGCATTTATGGAGCGCAGCGGTGGGGTTCTGGAAGTAAAAACGTGTCCTACATGTGTCTGTCTTTACCCTGAAAGAGCCAGGAATAAGCTGTGGTATTTTCAGCTCGCAACTTCAGAGACCATTTCAGCTT[C/A]GTGCAGGAACCTGAAGGACTGTCTCAGCATTGAGGTAAACACAAACAGAAATGCTCATATCATCTTGTTATTGATAGTTTTCACGTGACATACCCTGGTGGGCAAAACATTAATACCTCTTGCTGATCACCGAGCTACAGGCTGAGCAATCTCTCTTTTTTTTCACCAAAAAAAAAAAAAACTGTAGAAACAATAAGATATAGCGGTACTAACCAACGTGAGATATGCCTGATCTGAGCTTCTACAGAAATTTCTTCAGAGAAAGAACAGCCATTGACCCATAACAACCTATGGTACCTATAACTGTCAGTGTGTTTGTGTGCTTTTCATTCTGTTATGATCTGCAGCCGCTGGATCGCTATGAACTACAAATCCGCTGGTTTATGGACTACAGATCCAGTCATGCACCACACACACACACACACACATACCTGGTCCAAGCCTCCTTTGATTAGACTCACACATCTTAAGCTGCTCATAGACTGATTACACTCATGTAT
Associated Phenotype:
Not determined