Busch Lab

ZMP

si:ch211-198b3.2

Ensembl ID:
ENSDARG00000002847
ZFIN ID:
ZDB-GENE-041210-332
Description:
Novel protein similar to vertebrate fibronectin type III domain containing 1 (FNDC1) [Source:UniProt
Human Orthologue:
FNDC1
Human Description:
fibronectin type III domain containing 1 [Source:HGNC Symbol;Acc:21184]
Mouse Orthologues:
CT485609.1, Fndc1
Mouse Description:
fibronectin type III domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1915905]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa25140 Nonsense Mutation detected in F1 DNA Not yet available
sa23734 Nonsense Available for shipment Available now
sa45706 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa25140
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014163 Nonsense 599 1645 11 22
ENSDART00000136039 None None 110 None 4
ENSDART00000139643 None None 335 None 8
Genomic Location (Zv9):
Chromosome 20 (position 31063827)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 31135040
GRCz11 20 31037919
KASP Assay ID:
554-7520.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGAATCAAAACCCAGCAATTCTGACATTGTCCCTAAAACATCCGAGGAT[A/T]AACGTCCTCCTTGGACCCCTCGTACATCCTCAATTGTTGATATTAGTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23734
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014163 Nonsense 830 1645 11 22
ENSDART00000136039 None None 110 None 4
ENSDART00000139643 None None 335 None 8
Genomic Location (Zv9):
Chromosome 20 (position 31063134)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 31134347
GRCz11 20 31037226
KASP Assay ID:
2261-4505.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGATTCCACTTCCCATTCTTCTTCAAGGACTAACCCTTCTACAACAGGA[C/T]GAAGTTCATCCTTTTCGTTACCAAACCGAAATTCTAGAATAGTTACAAGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4911
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014163 Nonsense 1299 1645 14 22
ENSDART00000136039 None None 110 None 4
ENSDART00000139643 None None 335 None 8
Genomic Location (Zv9):
Chromosome 20 (position 31060998)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 31132211
GRCz11 20 31035090
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGCCCACCTGGACTTTATTCCCGATTGGATAAGAACGGTTTACCAATAT[T/A]GGATGCAGAAGGAATACTTAACTGTTACTCTGAAGGTAAGATGAACCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45706
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014163 Essential Splice Site 1361 1645 16 22
ENSDART00000136039 Essential Splice Site None 110 2 4
ENSDART00000139643 Essential Splice Site 51 335 2 8
Genomic Location (Zv9):
Chromosome 20 (position 31043810)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 31115023
GRCz11 20 31017902
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGACATTCTGAAACTCTTTTTTTCCTCTTATCTTTCCCTTCTGTCCTCA[G/A]CTCCATATGTAAACTACATTCAGAAAGACCCTGGAGCTCCCTGCTCCCTG
Associated Phenotype:
Not determined