Busch Lab

ZMP

rasgrf2

Ensembl ID:
ENSDARG00000002816
ZFIN ID:
ZDB-GENE-060504-1
Description:
Ras-specific guanine nucleotide-releasing factor 2 [Source:UniProtKB/Swiss-Prot;Acc:A2CEA7]
Human Orthologue:
RASGRF2
Human Description:
Ras protein-specific guanine nucleotide-releasing factor 2 [Source:HGNC Symbol;Acc:9876]
Mouse Orthologue:
Rasgrf2
Mouse Description:
RAS protein-specific guanine nucleotide-releasing factor 2 Gene [Source:MGI Symbol;Acc:MGI:109137]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa20530 Essential Splice Site Available for shipment Available now
sa1038 Nonsense F2 line generated Not yet available
sa14369 Essential Splice Site Available for shipment Available now
sa10502 Nonsense Available for shipment Available now
sa31477 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20530
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083350 Essential Splice Site 92 1244 1 27
Genomic Location (Zv9):
Chromosome 5 (position 53315849)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50797077
GRCz11 5 51443670
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCTGCGCTCAAGGTGTCCACTGTTGGCAAAGACGCACTTGACAAGCTGG[T/C]GAGTTCAGCGCTACTAACACACCTGTACAAATTGTGAGGGGTTTTGTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1038
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083350 Nonsense 163 1244 3 27
Genomic Location (Zv9):
Chromosome 5 (position 53373301)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50866240
GRCz11 5 51512833
KASP Assay ID:
554-0941.1 (used for ordering genotyping assays)
KASP Sequence:
TGGTGCAAATCGTGGAGACGGAGAAAGTGGCAGCAAACCAGCTCCGCACA[C/T]AACTGGAGGACCAAGACACTGAGATTGAGAGGCTTAAAGCTGAGGTAYGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14369
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083350 Essential Splice Site 207 1244 4 27
Genomic Location (Zv9):
Chromosome 5 (position 53376160)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50869025
GRCz11 5 51515618
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCATGTATTTCARGAAGAGGAAGATCCTGWTATWAAAAAAATTAAWAAGG[T/A]AAAAATAAACAACCTCCTGAGGTTATTCTGCAYGATCTCGATCATCATAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3509
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083350 Essential Splice Site 536 1244 12 27
Genomic Location (Zv9):
Chromosome 5 (position 53395134)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50888424
GRCz11 5 51535017
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACATCACAACATGCTCAAGTGTAAACTTCTGTTGTTTTTTTGTGTTCAC[A/G]GCTAAGAATTCAGGGCAGGTGTTCGGTCACCTTGACTTTAAGATTGTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10502
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083350 Nonsense 541 1244 12 27
Genomic Location (Zv9):
Chromosome 5 (position 53395150)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50888440
GRCz11 5 51535033
KASP Assay ID:
2259-6516.1 (used for ordering genotyping assays)
KASP Sequence:
CAAGTGTAAACTTCTGTTGTTTTTTTGTGTTCACRGCTAAGAATTCAGGG[C/T]AGGTGTTCGGTCACCTTGACTTTAAGATTGTGGTGGAGCCTTCAGATGCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26576
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083350 Nonsense 1123 1244 23 27
Genomic Location (Zv9):
Chromosome 5 (position 53431234)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50931753
GRCz11 5 51578346
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGAACCGCAGCGCCATCTACAGGCTGAAGAAGACATGGGCTAAAGTCTG[C/A]AAACAGGTTAGAGATACAATCAAAAATATGACTTTTGTTGCTTGCCCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31477
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083350 Nonsense 1181 1244 25 27
Genomic Location (Zv9):
Chromosome 5 (position 53431942)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50932466
GRCz11 5 51579059
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTTGACAGACCTCGCGTTTATCGAAGAGGGAACTCCAAATTTCACAGAG[G/T]AAGGTCTAGTTAACTTCTCAAAGATGAGAATGGTGAGGAATCATATCATA
Associated Phenotype:
Not determined