Busch Lab

ZMP

anxa11b

Ensembl ID:
ENSDARG00000002632
ZFIN ID:
ZDB-GENE-030707-5
Description:
annexin A11b [Source:RefSeq peptide;Acc:NP_861431]
Human Orthologue:
ANXA11
Human Description:
annexin A11 [Source:HGNC Symbol;Acc:535]
Mouse Orthologue:
Anxa11
Mouse Description:
annexin A11 Gene [Source:MGI Symbol;Acc:MGI:108481]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa22183 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22183
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023547 Nonsense 210 485 5 14
Genomic Location (Zv9):
Chromosome 12 (position 50263176)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 48876546
GRCz11 12 48829869
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTTTGTTGCAGGAACGGATGAAAACGCCATTATTGAGCTTCTGGGCAGT[C/T]GAAGCAACAAGCAGCGTGTGCCTTTGCTGGCGGCGTATAAAACCACCTAC
Associated Phenotype:
Not determined