Busch Lab

ZMP

rpa3

Ensembl ID:
ENSDARG00000002613
ZFIN ID:
ZDB-GENE-040426-977
Description:
replication protein A 14 kDa subunit [Source:RefSeq peptide;Acc:NP_956521]
Human Orthologue:
RPA3
Human Description:
replication protein A3, 14kDa [Source:HGNC Symbol;Acc:10291]
Mouse Orthologue:
Rpa3
Mouse Description:
replication protein A3 Gene [Source:MGI Symbol;Acc:MGI:1915490]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4812
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018553 Essential Splice Site 33 121 1 4
Genomic Location (Zv9):
Chromosome 19 (position 25950890)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 25881002
GRCz11 19 25465225
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTCTCAGTATATCAGTCGACCAGTCTGCTTCGTTGGACGCTTGGAGAAGG[T/A]ATTAACCTGTTTGCGCTATACACCCAACGTTAGCTTTTTATTAATGAACT
Associated Phenotype:
Not determined