Busch Lab

ZMP

irx7

Ensembl ID:
ENSDARG00000002601
ZFIN ID:
ZDB-GENE-020103-1
Description:
iroquois homeobox protein 7 [Source:RefSeq peptide;Acc:NP_571956]
Human Orthologue:
IRX1
Human Description:
iroquois homeobox 1 [Source:HGNC Symbol;Acc:14358]
Mouse Orthologue:
Irx1
Mouse Description:
Iroquois related homeobox 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1197515]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa32464 Essential Splice Site Available for shipment Available now
sa24393 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32464
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011627 Essential Splice Site 70 314 2 2
Genomic Location (Zv9):
Chromosome 23 (position 37909242)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 37884580
GRCz11 23 37816017
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACACTTTTCGCAATGATATTTATATTCTAAAATACTTCATGCTTACTTTC[A/G]GAGCAATTCCTATGACCTCAAGGCTGCATCGCCGTATCACCAAGCTCTCC
Long Flanking Sequence:
ACAACCGAAGTTCTTTGAAGGGATTTAGTCCCAGTGAAAGCCTTTGGACCGCAGCTGTCAATCAACCGCCCTGGCTCCGCCTACATTCGCTGCTCCTCCTATAAAGTGCGCCCGTGAACTCGAGTGTCATTTAAACACCAGAGCTCAGGGAGTAAGGATGCCTGCTTCATCAACGGGGTTTGCAAACTTCTTCATGGACAGAAACATCAACATGCCTGCTGGATATCAATTATTAGGCTGCCCACCTGGAATGCAACAGCCACCGCCACATCTTGTGGGAATGGCCGGGATGCCCTTACCTTTCTCAGGAATACCGGGCTACAGTTTCATCCCTTATCCTCATCCGGGACACATGGCACACATTGTAAGTAGTATTTTGACTGATTTCTAATATATGTGCATTAAAAAATAAATGTTTATTAATTTTAATTAGGATTAATGCAGGATGAAACACTTTTCGCAATGATATTTATATTCTAAAATACTTCATGCTTACTTTC[A/G]GAGCAATTCCTATGACCTCAAGGCTGCATCGCCGTATCACCAAGCTCTCCTCGGACGGGGAGGACCATACTACACCCCGTATCGTCCCATCCCAGCTGACGACCCCAGTCGGGTCACTAAAGTTGCCACCCGGGAAAGCACCAGCGCTTTGAAGGCCTGGCTCAGCGAGCACCTGAAAAACCCATATCCCACCAAAGGCGAGAAGATCATGCTTGCCATCGTCACCAAAATGAGCCTGACGCAGGTGTCGACGTGGTTCGCCAATGCGCGCCGCCGGTTAAAAAAAGAGAACCGGGTCAGCTGGGCGTCCAAAGGAAAATCTGACGAGGAGGATGAGGAAGAAGAGGGTGAGAGCGAAGAGGAAGGGTCTTTGAGGAAAGGCACTGAGGATGAAGATGAGATCGATCCTCAAACTGTTGACGATGAGGATGAAGAGGATGTCGTGGTGTCAAAGTCGGTGGAGCACCGTTTAGCGGGGGGACTCGAGCAGCAAAAGGAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa260
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011627 Nonsense 162 314 2 2
Genomic Location (Zv9):
Chromosome 23 (position 37909521)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 37884859
GRCz11 23 37816296
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATGAGCCTGACGCAGGTGTCGACGTGGTTCGCCAATGCGCGCCGCCGGT[T/A]AAAAAAAGAGAACCGGGTCAGCTGGGCGTCCAAAGGAAAATCTGACGAGG
Long Flanking Sequence:
AATGGCCGGGATGCCCTTACCTTTCTCAGGAATACCGGGCTACAGTTTCATCCCTTATCCTCATCCGGGACACATGGCACACATTGTAAGTAGTATTTTGACTGATTTCTAATATATGTGCATTAAAAAATAAATGTTTATTAATTTTAATTAGGATTAATGCAGGATGAAACACTTTTCGCAATGATATTTATATTCTAAAATACTTCATGCTTACTTTCAGAGCAATTCCTATGACCTCAAGGCTGCATCGCCGTATCACCAAGCTCTCCTCGGACGGGGAGGACCATACTACACCCCGTATCGTCCCATCCCAGCTGACGACCCCAGTCGGGTCACTAAAGTTGCCACCCGGGAAAGCACCAGCGCTTTGAAGGCCTGGCTCAGCGAGCACCTGAAAAACCCATATCCCACCAAAGGCGAGAAGATCATGCTTGCCATCGTCACCAAAATGAGCCTGACGCAGGTGTCGACGTGGTTCGCCAATGCGCGCCGCCGGT[T/A]AAAAAAAGAGAACCGGGTCAGCTGGGCGTCCAAAGGAAAATCTGACGAGGAGGATGAGGAAGAAGAGGGTGAGAGCGAAGAGGAAGGGTCTTTGAGGAAAGGCACTGAGGATGAAGATGAGATCGATCCTCAAACTGTTGACGATGAGGATGAAGAGGATGTCGTGGTGTCAAAGTCGGTGGAGCACCGTTTAGCGGGGGGACTCGAGCAGCAAAAGGAAAGTGACAAGTCTGACACTTTGACCAAAAGAGAGTCGTATAAACAAATCGCTGATGTCCAGAAACCTAAGATCTGGTCTCTGGCGGAAACGGCGACCTCAGATATCGTCAAGAAACCCAGCGATTTGAAACATCTCCAGACAAGTCCAGATTTCGGACAGTGGTGGGCTGGATGGCCTTCAAGGGACTCGTACTCTCCTGTAAACCTCTCCACACACGACCTTCTCAAACAAAGTCAATGAAACCAAGACACTACAGACTGAATATTTCTTGCACTTTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24393
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011627 Nonsense 234 314 2 2
Genomic Location (Zv9):
Chromosome 23 (position 37909736)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 37885074
GRCz11 23 37816511
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGTGTCAAAGTCGGTGGAGCACCGTTTAGCGGGGGGACTCGAGCAGCAA[A/T]AGGAAAGTGACAAGTCTGACACTTTGACCAAAAGAGAGTCGTATAAACAA
Long Flanking Sequence:
ACTTTCAGAGCAATTCCTATGACCTCAAGGCTGCATCGCCGTATCACCAAGCTCTCCTCGGACGGGGAGGACCATACTACACCCCGTATCGTCCCATCCCAGCTGACGACCCCAGTCGGGTCACTAAAGTTGCCACCCGGGAAAGCACCAGCGCTTTGAAGGCCTGGCTCAGCGAGCACCTGAAAAACCCATATCCCACCAAAGGCGAGAAGATCATGCTTGCCATCGTCACCAAAATGAGCCTGACGCAGGTGTCGACGTGGTTCGCCAATGCGCGCCGCCGGTTAAAAAAAGAGAACCGGGTCAGCTGGGCGTCCAAAGGAAAATCTGACGAGGAGGATGAGGAAGAAGAGGGTGAGAGCGAAGAGGAAGGGTCTTTGAGGAAAGGCACTGAGGATGAAGATGAGATCGATCCTCAAACTGTTGACGATGAGGATGAAGAGGATGTCGTGGTGTCAAAGTCGGTGGAGCACCGTTTAGCGGGGGGACTCGAGCAGCAA[A/T]AGGAAAGTGACAAGTCTGACACTTTGACCAAAAGAGAGTCGTATAAACAAATCGCTGATGTCCAGAAACCTAAGATCTGGTCTCTGGCGGAAACGGCGACCTCAGATATCGTCAAGAAACCCAGCGATTTGAAACATCTCCAGACAAGTCCAGATTTCGGACAGTGGTGGGCTGGATGGCCTTCAAGGGACTCGTACTCTCCTGTAAACCTCTCCACACACGACCTTCTCAAACAAAGTCAATGAAACCAAGACACTACAGACTGAATATTTCTTGCACTTTGAGTCCGTCAGGAACGTTTTGTTGTTGGATGTTTGCATAACAGATTTTGAATCCAATCTCCTGGTTTAAAAACCAAAGGATGTTGTGTAAATATTGTACAGCTATTTTGTTTAAATTATAAATGCATTTACCAGCTGACTTATTTTTGCTAAAATAAAAATGTGGAAAAATTGAAAGTTTTGATCACGGTTGATGTTGTATCTTACGAAAATAAGCTA
Associated Phenotype:
Not determined