Busch Lab

ZMP

tbx15

Ensembl ID:
ENSDARG00000002582
ZFIN ID:
ZDB-GENE-020529-1
Description:
T-box transcription factor TBX15 [Source:RefSeq peptide;Acc:NP_705950]
Human Orthologue:
TBX15
Human Description:
T-box 15 [Source:HGNC Symbol;Acc:11594]
Mouse Orthologue:
Tbx15
Mouse Description:
T-box 15 Gene [Source:MGI Symbol;Acc:MGI:1277234]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa41398 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa41398
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004333 Essential Splice Site 68 620 2 8

The following transcripts of ENSDARG00000002582 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 22097071)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21252857
GRCz11 9 21063726
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCCCTCGTCCTGCTGCTGGCGTTTATAATGATTTTATTTGTTCTTTGTA[G/T]ATTCAGAGGCCAGCCCGGGCTCTGACGGCGAGGGTCTGGCGGAGCGGACG
Associated Phenotype:
Not determined