Busch Lab

ZMP

syngr1a

Ensembl ID:
ENSDARG00000002564
ZFIN ID:
ZDB-GENE-041010-169
Description:
synaptogyrin-1 [Source:RefSeq peptide;Acc:NP_001006067]
Human Orthologue:
SYNGR1
Human Description:
synaptogyrin 1 [Source:HGNC Symbol;Acc:11498]
Mouse Orthologue:
Syngr1
Mouse Description:
synaptogyrin 1 Gene [Source:MGI Symbol;Acc:MGI:1328323]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18751
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003939 Nonsense 123 223 3 4
Genomic Location (Zv9):
Chromosome 3 (position 21471917)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 21128308
GRCz11 3 21258856
KASP Assay ID:
2259-3332.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCTCTCTCTCTCAGCCTTCTGGTCTTTCGTGTGGTTTGTGGGCTTCTG[T/A]TTTCTGGCCAATCAGTGGCAAGTGGCTAACCCAGAAGATAACCCTCTCAA
Associated Phenotype:
Not determined