Busch Lab

ZMP

noc3l

Ensembl ID:
ENSDARG00000002487
ZFIN ID:
ZDB-GENE-030131-9878
Description:
Nucleolar complex protein 3 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6DRN3]
Human Orthologue:
NOC3L
Human Description:
nucleolar complex associated 3 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:24034]
Mouse Orthologue:
Noc3l
Mouse Description:
nucleolar complex associated 3 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1932610]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa35204 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa41960 Nonsense Mutation detected in F1 DNA Not yet available
sa9387 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa9316 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa35204
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028043 Essential Splice Site 74 800 2 21

The following transcripts of ENSDARG00000002487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 6370124)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5381201
GRCz11 12 5416158
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTTCCCATCAGACCCTCAAACCCCTGGAGCGCTACAAGAAGAGACCCGG[T/C]GAGCCAACATTGGTTTCTGGGTTGTTTTGCATGAGCTCAGTGCTGTTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41960
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028043 Nonsense 305 800 8 21

The following transcripts of ENSDARG00000002487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 6376100)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5375225
GRCz11 12 5410182
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGAGACGCTGCAGCTCAGAGAGTTTGAGGAGGGTCTGGTCAGCCAGTA[T/G]AAGTTTTACCTGGAGGAGCTGGAACAGACAGTCAAAGGTAGATCTCTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9387
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028043 Essential Splice Site 318 800 9 21
ENSDART00000028043 Essential Splice Site 318 800 9 21

The following transcripts of ENSDARG00000002487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 6376208)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5375117
GRCz11 12 5410074
KASP Assay ID:
2260-4929.1 (used for ordering genotyping assays)
KASP Sequence:
CTACYTGTTCATCCATTGTTTGTTTGTCTGACTGATCTGCTGTCGTTTCA[G/T]ACTGGAAGCAGAAGAAGGAGAAGAGAAGTCAGGCCGTGTCTCTGCAGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9316
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028043 Essential Splice Site 318 800 9 21
ENSDART00000028043 Essential Splice Site 318 800 9 21

The following transcripts of ENSDARG00000002487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 6376208)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5375117
GRCz11 12 5410074
KASP Assay ID:
2260-4929.1 (used for ordering genotyping assays)
KASP Sequence:
CTACYTGTTCATCCATTGTTTGTTTGTCTGACTGATCTGCTGTCGTTTCA[G/T]ACTGGAAGCAGAAGAAGGAGAAGAGAAGTCAGGCCGTGTCTCTGCAGTCC
Associated Phenotype:
Not determined