Busch Lab

ZMP

si:ch211-278b8.3

Ensembl ID:
ENSDARG00000002479
ZFIN ID:
ZDB-GENE-060531-56
Description:
DNA excision repair protein ERCC-6-like [Source:UniProtKB/Swiss-Prot;Acc:A2BGR3]
Human Orthologue:
ERCC6L
Human Description:
excision repair cross-complementing rodent repair deficiency, complementation group 6-like [Source:H
Mouse Orthologue:
Ercc6l
Mouse Description:
excision repair cross-complementing rodent repair deficiency complementation group 6 - like Gene [So

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa40415 Nonsense Mutation detected in F1 DNA Not yet available
sa2215 Nonsense F2 line generated Not yet available
sa31433 Nonsense Available for shipment Available now
sa20402 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26462
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015401 Nonsense 218 1451 3 4
Genomic Location (Zv9):
Chromosome 5 (position 25589148)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23416413
GRCz11 5 23920213
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGTAAGGGAGGAGTCATCATCACCACCTACCAGATGCTCATAAACAACTA[T/A]GAGCAACTTGGATCAAATGGCCATCGTGAGTTCAAATGGGACTACGTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40415
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015401 Nonsense 299 1451 3 4
Genomic Location (Zv9):
Chromosome 5 (position 25589391)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23416656
GRCz11 5 23920456
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTTGCCAAGGATCACTCTTGGGAACCTCCAAAACGTTCAAAACCGAGTA[T/A]GAGAATCCAATCACACGAGCAAGGGAGAAAGATGCCACACCTGGGGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2215
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015401 Nonsense 359 1451 3 4
Genomic Location (Zv9):
Chromosome 5 (position 25589569)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23416834
GRCz11 5 23920634
KASP Assay ID:
554-2743.1 (used for ordering genotyping assays)
KASP Sequence:
TTCAGCAGAAAAAACTAAAGCTTGAAGAAGGCTTTGAAGAGGAAGAAGAT[C/T]AAGAGAATAAATGTCCAAATGCTAGAGAAGGCGTAGAGATGCCGTCGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31433
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015401 Nonsense 1081 1451 4 4
ENSDART00000015401 Nonsense 1081 1451 4 4
Genomic Location (Zv9):
Chromosome 5 (position 25594075)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23421340
GRCz11 5 23925140
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAACCAAGTATCAACCATGACAAACAAAACAATGGGGAGTTTGTCAATTA[T/A]AACGACAGTGAAGTCAGCAAACGTGAATCTCTTTTAAAGATCCGTTCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20402
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015401 Nonsense 1081 1451 4 4
ENSDART00000015401 Nonsense 1081 1451 4 4
Genomic Location (Zv9):
Chromosome 5 (position 25594075)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23421340
GRCz11 5 23925140
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAACCAAGTATCAACCATGACAAACAAAACAATGGGGAGTTTGTCAATTA[T/A]AACGACAGTGAAGTCAGCAAACGTGAATCTCTTTTAAAGATCCGTTCTAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1440
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015401 Nonsense 1404 1451 4 4
Genomic Location (Zv9):
Chromosome 5 (position 25595043)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23422308
GRCz11 5 23926108
KASP Assay ID:
554-1367.1 (used for ordering genotyping assays)
KASP Sequence:
TGTCAGCTCCACAAACACCGCTGCTGAAGCTTCTGACAACAAGTACAAKT[T/A]GCTGGTTCTGTCTGGGAARCAAAGTTTGGCAGAAGGGARGAAGCAGGAAG
Associated Phenotype:
Not determined