Busch Lab

ZMP

ARHGEF37

Ensembl ID:
ENSDARG00000002463
Description:
Rho guanine nucleotide exchange factor (GEF) 37 [Source:HGNC Symbol;Acc:34430]
Human Orthologue:
ARHGEF37
Human Description:
Rho guanine nucleotide exchange factor (GEF) 37 [Source:HGNC Symbol;Acc:34430]
Mouse Orthologue:
Arhgef37
Mouse Description:
Rho guanine nucleotide exchange factor (GEF) 37 Gene [Source:MGI Symbol;Acc:MGI:3045339]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
hu3278 Essential Splice Site Available for shipment Available now
sa45516 Nonsense Mutation detected in F1 DNA Not yet available
sa22474 Essential Splice Site Available for shipment Available now
sa18496 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3889
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106039 Nonsense 153 709 3 12
Genomic Location (Zv9):
Chromosome 14 (position 25852285)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 24555376
GRCz11 14 24852621
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACTCTTTCTTGAGTCTGTCTCAAGATATTGAAATGGCTTATAAGGAGTA[T/A]CTTGCCAACTACAACAAYATCACCGCTCTGGAAAACAGCTACAAACAGAA
Long Flanking Sequence:
ATAAAATAAAAATAAAAGAGCATAAATATAACATGGGAAATCCGTTTTCAATACAGTTAAATTTATGCTGGGACATTGTGATCACTTCTATATATGGTAGAGGTGCAGGAAAGCCAATTTAATGGGTGGAAATAAATAACAGCACACTATTACGACATGATATTAACCATCACATCAATTCAGGAGTTATAGAGAATGATAAATAGTGGTAGTGGTGGTGTTGTTATATTACAATTATATTGTTGTTTATTGTGGTAGTGGTGGTGGTGTTATATTAAATTTAAATTGTTGTAGTTTAATAATTAATAAGATTATTTATCTTGCCATGAAATAGTCATGAGTTGCTGATATGGCAATAAATAAACAAACTCTAAGGTTTCTGACCCCTAAACTATTAAATGGTCAATTTTCAAATTTAAATTCTAAAGTATCTTATTTTATTTCCCAGGTGACTCTTTCTTGAGTCTGTCTCAAGATATTGAAATGGCTTATAAGGAGTA[T/A]CTTGCCAACTACAACAATATCACCGCTCTGGAAAACAGCTACAAACAGAAAGAGGCCCTGTGGATGGAGATGGTCAGAATCATCAAATCCTCTGCGTAAGTCTAACAACAACCAACAGAGGATGTATACATCTTCAACCCTGTTGAGAGAAGAATGACTTCTTAGAAAAACACACTAGTCTTTTACCCAGCATTCCTTTCATTTTTGACCCCTGATCTTGTCTGTCTTCAGTCCTGATGTGAACGCGTCTACTTTGAGCTTCTTCCTGGTAATGCCGGTCCAGAGAATCGCCCGTTACCCCCTACTTTTCCAGACCATTCAGAAACACACAGACCCCCAACACCCTGCCTACCCTGAACTGGAGCACACCGCTCACACGGCCATCCAGATCAACTGCAGGATCAATGAATACAAACGCTTCCGTGAAGTGGGTGAGAGAACATGCTCGCAATTTATCACGCAAAGCTGGCTGAACACAAGTACGTCAATTTATTCAGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu3278
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106039 Essential Splice Site 252 709 4 12
Genomic Location (Zv9):
Chromosome 14 (position 25852718)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 24555809
GRCz11 14 24853054
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCCAGATCAACTGCAGGATCAATGAATACAAACGCTTCCGTGAAGTGGG[T/A]GAGAGAACATGCTCGCAATTTATCACGCAAAGCTGGCTGAACACAAGTAC
Long Flanking Sequence:
TATTTTATTTCCCAGGTGACTCTTTCTTGAGTCTGTCTCAAGATATTGAAATGGCTTATAAGGAGTATCTTGCCAACTACAACAATATCACCGCTCTGGAAAACAGCTACAAACAGAAAGAGGCCCTGTGGATGGAGATGGTCAGAATCATCAAATCCTCTGCGTAAGTCTAACAACAACCAACAGAGGATGTATACATCTTCAACCCTGTTGAGAGAAGAATGACTTCTTAGAAAAACACACTAGTCTTTTACCCAGCATTCCTTTCATTTTTGACCCCTGATCTTGTCTGTCTTCAGTCCTGATGTGAACGCGTCTACTTTGAGCTTCTTCCTGGTAATGCCGGTCCAGAGAATCGCCCGTTACCCCCTACTTTTCCAGACCATTCAGAAACACACAGACCCCCAACACCCTGCCTACCCTGAACTGGAGCACACCGCTCACACGGCCATCCAGATCAACTGCAGGATCAATGAATACAAACGCTTCCGTGAAGTGGG[T/A]GAGAGAACATGCTCGCAATTTATCACGCAAAGCTGGCTGAACACAAGTACGTCAATTTATTCAGAACAGCATCACATAAACATGAGTAATTATTGTCATTCTCTTGACTACCACAGCTGACAAGTACAAGAAGACAGAAAACCTGACCATCAAGGACAAGCTTAATCGGTTGAGTGGCCACAGCATTGCTAAGAAGACAGCCCGGTTCAGCCAGTATATAAAGCATGAGACCGGAATAGTGCCAAAGGTAACTTCTGTACAATTATGCTATACATAGAAGAACAATACCTTGTGTACACACAGACATTTAAATGTTTAACTTGTTGAAAGAACCACATTGTTTTCCTAAAACCTAAGACGCCATTGCCTATTTTAAAAGTTAAAGGGATAGTTCACCCAAAATTTAATTATTTACTCATCCTTTACTAGTTCAAATTAGATTGAAAGTATTTCTTGGTTGTGTTGGACATAAAAGAAGAATTATTAAAAAATGTTGGAAA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa45516
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106039 Nonsense 362 709 7 12
Genomic Location (Zv9):
Chromosome 14 (position 25855167)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 24558258
GRCz11 14 24855503
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGGGGAGAAAACCGCCTTGTTCTCCAAAGAAATCACAGTGGCGCTCAGA[C/T]AGTGGATATACCCCTCATATGTAAGACTTTTAGATAATTATTACAGTTTG
Long Flanking Sequence:
AATCCCATTGTAGTTAAAGGATGAAGAATTCGATGCCCTAGCTGGCTTCTTCTTTGTCCTGGAAAGGGGCGTCTCAGAGCTTCATGATAACCTGCTGACTTATCTCCACCATTTACAGGTTTGGATTTACATTTCTTCCACATAATGACTGCAGCTAAACCTAGACAAAGAGTCTGTCTAATTTGTTTTGGTGTTCCCTTAGTATGAACCCAGTACGCCCATGAAAACTTCTGAAATGTTTTTCACTGTTATTCCAGCTGGTGAATAAAAGAAAAAAATCTACAGAAGGGTTGATCCCAGGGCTGATGGATGGGGTTATTGGAGATTGTAAAGTTCAGATGTTTGCTATGTGTGCTTGCAGTGTTTGTAAAGATTTATTTAACATCCTGAGCTGTTTCTGTGTACAGAGGTTCCTCAGCTGCAGACCAGAGGAAGCAGATCTTGATCTTGAAGGGGAGAAAACCGCCTTGTTCTCCAAAGAAATCACAGTGGCGCTCAGA[C/T]AGTGGATATACCCCTCATATGTAAGACTTTTAGATAATTATTACAGTTTGTGTCCCTGGGCCACAATACTTGTCATAAGTGTGCTATTTTTATTTCTGAAAAATTAAGCTTTCAATTAATGTTTGGCTTCTTAGAATAGGAAATCTAGAATTTGAAGTTTTAAAAAAAACATAATACTGAGAAAATCACCTTTAATGTGTCTAAATTAATTGGTTAGCTATGCATATTATTAATGAAAAAAAGAGTTTTGATATATTTACAGTATGATGTTTACAAAATATCTTCATGAAGCATGATCTTTACTTAATATTTGAATGATTTTTAGCCTATACAATGTATTTTTGGCCTATGCTACAATATACTCCTGCAACTTAATACTGAGGTTCTAAGACTGAAGTTAGGCTAGACTACAGTCACATTACTTCAACATTTCCATCATAACTTTTTAGTCTTTATTTAAATTCTGAAAGTTGGAAAATGTGTTAAAATAGTTTGCAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22474
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106039 Essential Splice Site 368 709 7 12
Genomic Location (Zv9):
Chromosome 14 (position 25855189)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 24558280
GRCz11 14 24855525
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCCAAAGAAATCACAGTGGCGCTCAGACAGTGGATATACCCCTCATATG[T/A]AAGACTTTTAGATAATTATTACAGTTTGTGTCCCTGGGCCACAATACTTG
Long Flanking Sequence:
GAAGAATTCGATGCCCTAGCTGGCTTCTTCTTTGTCCTGGAAAGGGGCGTCTCAGAGCTTCATGATAACCTGCTGACTTATCTCCACCATTTACAGGTTTGGATTTACATTTCTTCCACATAATGACTGCAGCTAAACCTAGACAAAGAGTCTGTCTAATTTGTTTTGGTGTTCCCTTAGTATGAACCCAGTACGCCCATGAAAACTTCTGAAATGTTTTTCACTGTTATTCCAGCTGGTGAATAAAAGAAAAAAATCTACAGAAGGGTTGATCCCAGGGCTGATGGATGGGGTTATTGGAGATTGTAAAGTTCAGATGTTTGCTATGTGTGCTTGCAGTGTTTGTAAAGATTTATTTAACATCCTGAGCTGTTTCTGTGTACAGAGGTTCCTCAGCTGCAGACCAGAGGAAGCAGATCTTGATCTTGAAGGGGAGAAAACCGCCTTGTTCTCCAAAGAAATCACAGTGGCGCTCAGACAGTGGATATACCCCTCATATG[T/A]AAGACTTTTAGATAATTATTACAGTTTGTGTCCCTGGGCCACAATACTTGTCATAAGTGTGCTATTTTTATTTCTGAAAAATTAAGCTTTCAATTAATGTTTGGCTTCTTAGAATAGGAAATCTAGAATTTGAAGTTTTAAAAAAAACATAATACTGAGAAAATCACCTTTAATGTGTCTAAATTAATTGGTTAGCTATGCATATTATTAATGAAAAAAAGAGTTTTGATATATTTACAGTATGATGTTTACAAAATATCTTCATGAAGCATGATCTTTACTTAATATTTGAATGATTTTTAGCCTATACAATGTATTTTTGGCCTATGCTACAATATACTCCTGCAACTTAATACTGAGGTTCTAAGACTGAAGTTAGGCTAGACTACAGTCACATTACTTCAACATTTCCATCATAACTTTTTAGTCTTTATTTAAATTCTGAAAGTTGGAAAATGTGTTAAAATAGTTTGCAAGAACACAGTTGAGCATAATTTAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18496
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106039 Nonsense 498 709 9 12
Genomic Location (Zv9):
Chromosome 14 (position 25859532)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 24562623
GRCz11 14 24859868
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTGGTGACTTCTGGAAGTGGGCAGAGACCTCTGTGCTGGAGGGTTCGTG[G/A]AGGATGGAGAGCCTGTGTCGGAGTRTTCAAGATGAGCTCAATGCTCCCAT
Long Flanking Sequence:
CTTTTTTAATAAATCTGCAAATATTTCAACAAGTCAGTGTTTTTCTGTCAATATGGCGTGCTGTGTGTGCATAAATAAGGAAAAATGAACTTAAATGACTTTAGCAATTGACTGGGGGTCTGAACACCTTTCGTACCCACTGTATACAAGACATTGTGTAGTTTTTTTAGCATGGGAATATTACAGAAGAAGTGCACCTTTGTTTTATCTGTATCTGTGTCTGTGGAACTCTTCTTTCCAGGTCATCTAGTTTAGTTATCCTCATGACTTCAGTTACACATAAATACCCTTCAGTTTCTCAAACTGTTGCACATTTTGTGCAATAATCCACCATTGAACGACAGCAGCAAACATGTGGTTGGAAAAGTGATTGAATTTAGCTTTTTGTAGGCTGGCAGTGTTTATGAATTGCTCTCTGTCTGCTGACAGCTCCCACACAGTTATTTGGAGGCTGGTGACTTCTGGAAGTGGGCAGAGACCTCTGTGCTGGAGGGTTCGTG[G/A]AGGATGGAGAGCCTGTGTCGGAGTGTTCAAGATGAGCTCAATGCTCCCATTGTGCAGGTCAGTTCCTAAACAGAGATGCACTATTGTCTGTTGCCTGGTGGAGATGTCTTCATAAGAGATTGTTTGTCCCCTTATTGTGGTTTAATATTGGCTGTGGACGGTTCTGGAATGAAACCACAAGTTGATGTCATTCATTAATCTTGGTATGGATTAGCCCTCATATGTTATGCATCAGTTTATCCATTATGAACACTTAGCAAAAATATGCTGGGTCCTGTGGTTATAGTTTTTTTATTGTGTGGTTATTTGTTCTCTGAACATCTGCTTTTCATTTAGTTAAATGCAAATTACAGTTGATCAACAACCATGTTATGAATTAAATTTTAAATCCTTAATCAAAAAGAAGTTTAACCAAAACGTAACAAGATAACCGGGATCATAACATAATCCCTGGTGCCCCTGTGCTCTCTCCCCACCAAACATAAACCAAAACACAAACC
Associated Phenotype:
Not determined