Busch Lab

ZMP

zgc:63660

Ensembl ID:
ENSDARG00000002406
ZFIN ID:
ZDB-GENE-040426-1218
Description:
zinc finger MYND domain-containing protein 10 [Source:RefSeq peptide;Acc:NP_956691]
Human Orthologue:
ZMYND10
Human Description:
zinc finger, MYND-type containing 10 [Source:HGNC Symbol;Acc:19412]
Mouse Orthologue:
Zmynd10
Mouse Description:
zinc finger, MYND domain containing 10 Gene [Source:MGI Symbol;Acc:MGI:2387863]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa31203 Essential Splice Site Available for shipment Available now
sa38262 Nonsense Mutation detected in F1 DNA Not yet available
sa6582 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1969
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017413 Nonsense 22 448 1 12
Genomic Location (Zv9):
Chromosome 1 (position 21465502)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22000669
GRCz11 1 22691408
KASP Assay ID:
554-2551.1 (used for ordering genotyping assays)
KASP Sequence:
TCTACAYGRAGAAGCTGAAGGATAYATTCAAAGCCTGGAAAAGATGTCAT[T/A]GCGCGAWATCGGAAGCCCGAGGTAARTTACGAGAATATWAYATTATAAGT
Long Flanking Sequence:
CTATAGCTTCCAAGAATCCAAAAAGAGTCACATATTGATAAATAATGTTATGACAGCTGTTTTAACATTAAGTTATGACTGAATTGCCCCTTGTTACAGTTATGAAATAGTTTGATAACAATCAGGGAATGTTCATGGGTCAATGATATGACCACATTTAAACTATTATTACTAATTTGATAACAAATGACAATATGTGAAGCGTCAGAAAGCAAGAAAATAAACAACTTAGCTTTAGGAGGACATTTTTACAGCTTTCTTGTTAGAAGAATAATCTTTTAAGGGGGATCAAATTTTCCCCCACTCCGTCACTTCCGCACTCAGTGTACCTGTAACCATAGTGACGAAACGGAAGATGATATCCCCTAATAGAAGTATAATAGAGTGTGTTTGAAAAGCTGCTAGTTTAGGTTTCTGTAGAAAACATTCTGAAGCGATGGATTCAGTACTTCTACACGAAGAAGCTGAAGGATACATTCAAAGCCTGGAAAAGATGTCAT[T/A]GCGCGATATCGGAAGCCCGAGGTAAATTACGAGAATATAACATTATAAGTCAAGGATCGGTAAAATAAGAACACGTAATCTAATCCAAAACTAGTATAGCCATGCCATCGTTGTCATGCATAGCCAATGTTGTGTGTGTGTGTTTATTTATTTATTTATTTTTGTAAAGATGGTTTCGCCAGCATGAATTTATTGAGAAGCTGAATATGCAAGCTATTCTGAACGCCAGCGCCAATCAGGAGGAATTCATTAAAGACCTTTTCGTTTCTCTCGGAAAGGTAAATTAAATATGATTTTGTTTTGTCGGTCAGTTTCTATACAGGGAATATCATGATATTTTCATGATAGCAGTAATTGTATGTAAACTTTAATGGGATTATAATGTTGTTACTCACTTGATAGAGAGAAATTGTACTCAGGTATAACGTTACTAATATTTATGACCAAAATGTATTGTGGAGAAAAAAAATATGCTTGCCTTGTTCATACTTTTAATACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31203
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017413 Essential Splice Site 29 448 2 12
Genomic Location (Zv9):
Chromosome 1 (position 21465671)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22000838
GRCz11 1 22691577
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATAGCCAATGTTGTGTGTGTGTGTTTATTTATTTATTTATTTTTGTAAA[G/A]ATGGTTTCGCCAGCATGAATTTATTGAGAAGCTGAATATGCAAGCTATTC
Long Flanking Sequence:
TACTAATTTGATAACAAATGACAATATGTGAAGCGTCAGAAAGCAAGAAAATAAACAACTTAGCTTTAGGAGGACATTTTTACAGCTTTCTTGTTAGAAGAATAATCTTTTAAGGGGGATCAAATTTTCCCCCACTCCGTCACTTCCGCACTCAGTGTACCTGTAACCATAGTGACGAAACGGAAGATGATATCCCCTAATAGAAGTATAATAGAGTGTGTTTGAAAAGCTGCTAGTTTAGGTTTCTGTAGAAAACATTCTGAAGCGATGGATTCAGTACTTCTACACGAAGAAGCTGAAGGATACATTCAAAGCCTGGAAAAGATGTCATTGCGCGATATCGGAAGCCCGAGGTAAATTACGAGAATATAACATTATAAGTCAAGGATCGGTAAAATAAGAACACGTAATCTAATCCAAAACTAGTATAGCCATGCCATCGTTGTCATGCATAGCCAATGTTGTGTGTGTGTGTTTATTTATTTATTTATTTTTGTAAA[G/A]ATGGTTTCGCCAGCATGAATTTATTGAGAAGCTGAATATGCAAGCTATTCTGAACGCCAGCGCCAATCAGGAGGAATTCATTAAAGACCTTTTCGTTTCTCTCGGAAAGGTAAATTAAATATGATTTTGTTTTGTCGGTCAGTTTCTATACAGGGAATATCATGATATTTTCATGATAGCAGTAATTGTATGTAAACTTTAATGGGATTATAATGTTGTTACTCACTTGATAGAGAGAAATTGTACTCAGGTATAACGTTACTAATATTTATGACCAAAATGTATTGTGGAGAAAAAAAATATGCTTGCCTTGTTCATACTTTTAATACAAGTCCTGCAAACAAAGGTTAGATTTATCTTATGGTTAAAATATTGTACATTATTAATTAATTAATTAATTAATTTATTTATTTATTTATTAAAAACTAAGAGACCACAATCCAGTTTTTCTGGATTTATTATCGGTTTGAGTTAGATTTTATTATTTGATGTAGTTTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38262
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017413 Nonsense 257 448 8 12
Genomic Location (Zv9):
Chromosome 1 (position 21470677)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22005844
GRCz11 1 22696583
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGAGGGCAAATGGAGAGCCGTCCTCCCTGAAGATCAGCTGAAGCTGAGT[A/T]AACATGATGGCCAGGTGTGGATAGCTTTACTAAACCTGATGCTCAAACCA
Long Flanking Sequence:
CTACTTAAAGGCCTATGAAAGGTTTGAAATGTGCATTTTTATATTTAATGTTTGACAGTATTAACTAAAACATGAATACAGGGTGGGACATAGAGTAGCTCCTCCCCTTTTAAATCAGCTCTGCCAGTGAGAGTGGTTGAGCTTAAGTGCATCAAATGAAAAGCAGTCACAAACTTCAAACTTTGGATGTTTAAATCTTCTAAATGTCTTTGTCACTGTTTTGGAGCACACAAGCTTGACTAAAACTGACATACTCATACTAATACTTGTACTTTTTTAACATCTAAAAAATTATTTTAATTTCACAGGCACTTTAAATCCATAACACTTTCATAGACCTACATTAGAAAAGAGCAAAAGCTTATAATATGATGCACAGCAACAGTTGCTAAGGTAGGATTGACTGCTGGAAGTCTTTTTTTCTCTACATAGGTACACAGGAGAAATACACAGAGGGCAAATGGAGAGCCGTCCTCCCTGAAGATCAGCTGAAGCTGAGT[A/T]AACATGATGGCCAGGTGTGGATAGCTTTACTAAACCTGATGCTCAAACCAGACTGCCAGCGGAAATATGATTTCAACAGCTTCAATAAAACACAACTCTTAAAAGTAAGACTTTAAATATTTGCTTTTCAATAAGGGTTCCTGTAGTGTATCAAGTTGGTATATAAAACTTACATTTTGATTTTGATTCAGACATTAAATATCTGAAGAGGGGATAAATCTGCATTATTCAACGCTGAGTTTGATTTACTCATAACCTAAACATACAGTCTGTTCCTCTAATTCTGATTTATTCAATGTCAAAGATAATTACTGTATGATTTTTTTCTCTGTCTGCATGCAGCTTCGTGGGTTTCTGACAGATGTTGTGATAGATCAGTTACCAAACTTACTTGATCTCAAGCATTTCCTCAGTCAACTTGCTCTCACAGATCCAGTGGCTCCTAAAAAAGATCTCATCTTGGAGCAGGTATTCTACAAACACATATATGTACACTTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6582
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017413 Nonsense 263 448 8 12
Genomic Location (Zv9):
Chromosome 1 (position 21470697)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22005864
GRCz11 1 22696603
KASP Assay ID:
554-4052.1 (used for ordering genotyping assays)
KASP Sequence:
GTCCTCCCTGAAGATCAGCTGAAGCTGAGTAAACATGATGGCCAGGTGTG[G/A]ATAGCYTTACTAAACCTGATGCTCAAACCAGACTGCCAGCGGAAATATGA
Long Flanking Sequence:
GGTTTGAAATGTGCATTTTTATATTTAATGTTTGACAGTATTAACTAAAACATGAATACAGGGTGGGACATAGAGTAGCTCCTCCCCTTTTAAATCAGCTCTGCCAGTGAGAGTGGTTGAGCTTAAGTGCATCAAATGAAAAGCAGTCACAAACTTCAAACTTTGGATGTTTAAATCTTCTAAATGTCTTTGTCACTGTTTTGGAGCACACAAGCTTGACTAAAACTGACATACTCATACTAATACTTGTACTTTTTTAACATCTAAAAAATTATTTTAATTTCACAGGCACTTTAAATCCATAACACTTTCATAGACCTACATTAGAAAAGAGCAAAAGCTTATAATATGATGCACAGCAACAGTTGCTAAGGTAGGATTGACTGCTGGAAGTCTTTTTTTCTCTACATAGGTACACAGGAGAAATACACAGAGGGCAAATGGAGAGCCGTCCTCCCTGAAGATCAGCTGAAGCTGAGTAAACATGATGGCCAGGTGTG[G/A]ATAGCTTTACTAAACCTGATGCTCAAACCAGACTGCCAGCGGAAATATGATTTCAACAGCTTCAATAAAACACAACTCTTAAAAGTAAGACTTTAAATATTTGCTTTTCAATAAGGGTTCCTGTAGTGTATCAAGTTGGTATATAAAACTTACATTTTGATTTTGATTCAGACATTAAATATCTGAAGAGGGGATAAATCTGCATTATTCAACGCTGAGTTTGATTTACTCATAACCTAAACATACAGTCTGTTCCTCTAATTCTGATTTATTCAATGTCAAAGATAATTACTGTATGATTTTTTTCTCTGTCTGCATGCAGCTTCGTGGGTTTCTGACAGATGTTGTGATAGATCAGTTACCAAACTTACTTGATCTCAAGCATTTCCTCAGTCAACTTGCTCTCACAGATCCAGTGGCTCCTAAAAAAGATCTCATCTTGGAGCAGGTATTCTACAAACACATATATGTACACTTGGGATTAGTAAATTTTCATAGGC
Associated Phenotype:
Not determined