Busch Lab

ZMP

si:ch211-202a12.4

Ensembl ID:
ENSDARG00000002369
ZFIN ID:
ZDB-GENE-030131-8486
Description:
ubiquitin B (ubb), mRNA [Source:RefSeq DNA;Acc:NM_001013272]
Human Orthologues:
UBB, UBC
Human Descriptions:
ubiquitin B [Source:HGNC Symbol;Acc:12463]
ubiquitin C [Source:HGNC Symbol;Acc:12468]
Mouse Orthologues:
Ubb, Ubc
Mouse Descriptions:
ubiquitin B Gene [Source:MGI Symbol;Acc:MGI:98888]
ubiquitin C Gene [Source:MGI Symbol;Acc:MGI:98889]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa33681 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa33681
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035235 Nonsense 170 459 2 2
ENSDART00000123908 None None 235 None 5
ENSDART00000129092 None None 480 None 4
Genomic Location (Zv9):
Chromosome 5 (position 43686036)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41467301
GRCz11 5 42067454
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCAGATCTTCGTCAAGACCCTTACTGGTAAGACCATCACCCTTGAGGTC[G/T]AGCCAAGTGACACCATTGAGAATGTCAAGGCTAAAATCCAGGACAAAGAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18817
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035235 None None 459 None 2
ENSDART00000123908 None None 235 None 5
ENSDART00000129092 Nonsense 147 480 2 4
Genomic Location (Zv9):
Chromosome 5 (position 43713278)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41494543
GRCz11 5 42094696
KASP Assay ID:
2259-6368.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAAAGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCTGGCAAA[C/T]AGCTAGAAGATGGACGCACCCTGTCCGACTACAACATCCAGAAAGAGTCC
Associated Phenotype:
Not determined