Busch Lab

ZMP

fam102bb

Ensembl ID:
ENSDARG00000002333
ZFIN ID:
ZDB-GENE-041014-330
Description:
hypothetical protein LOC557909 [Source:RefSeq peptide;Acc:NP_001038309]
Human Orthologue:
FAM102B
Human Description:
family with sequence similarity 102, member B [Source:HGNC Symbol;Acc:27637]
Mouse Orthologue:
Fam102b
Mouse Description:
family with sequence similarity 102, member B Gene [Source:MGI Symbol;Acc:MGI:3036259]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa43483 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa16607 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43483
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020183 Essential Splice Site 45 367 1 11
Genomic Location (Zv9):
Chromosome 20 (position 33814177)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33886690
GRCz11 20 33789569
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGTAAAGTCCGACTGCTCGACGGCGGATTCTCAGAAGAATCTTCGCGG[T/C]AAGAAACCTGTCAGATCTTCAGTGGATTAGTATGATTGGTTTAGATGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16607
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020183 Nonsense 121 367 4 11
Genomic Location (Zv9):
Chromosome 20 (position 33796162)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33868675
GRCz11 20 33771554
KASP Assay ID:
2261-4592.1 (used for ordering genotyping assays)
KASP Sequence:
GAGTTTGCWGGATCGGGTAGCACCAYACGCAGGTGTCTGTTGGAGGGTTA[C/A]GACAYCAAAAACACTAGACAGGACAACTCCATCCTTAAGGTATGAAGACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4107
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020183 Essential Splice Site 150 367 5 11
Genomic Location (Zv9):
Chromosome 20 (position 33792990)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33865503
GRCz11 20 33768382
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGTGATTATTAGCACACAGCTGATGTCCGGAGACCCCTGTTTCAAAACG[T/A]GAGTCTTACTCTTYATACCCGTCAATGTTAGAATTTGATTGCTGACACTA
Associated Phenotype:
Not determined